Incidental Mutation 'R5492:Zfp703'
ID432121
Institutional Source Beutler Lab
Gene Symbol Zfp703
Ensembl Gene ENSMUSG00000085795
Gene Namezinc finger protein 703
SynonymsZeppo1, End2, 1110032O19Rik, Csmn1
MMRRC Submission 043053-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock #R5492 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location26977325-26981461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26979205 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 299 (P299L)
Ref Sequence ENSEMBL: ENSMUSP00000128757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127097] [ENSMUST00000154256] [ENSMUST00000209411] [ENSMUST00000209610]
Predicted Effect probably benign
Transcript: ENSMUST00000127097
SMART Domains Protein: ENSMUSP00000132801
Gene: ENSMUSG00000085795

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154256
AA Change: P299L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128757
Gene: ENSMUSG00000085795
AA Change: P299L

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
low complexity region 133 145 N/A INTRINSIC
low complexity region 164 191 N/A INTRINSIC
low complexity region 212 231 N/A INTRINSIC
low complexity region 261 275 N/A INTRINSIC
Pfam:nlz1 315 369 3.6e-24 PFAM
low complexity region 426 442 N/A INTRINSIC
ZnF_C2H2 460 488 1.16e1 SMART
low complexity region 497 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209411
Predicted Effect probably benign
Transcript: ENSMUST00000209610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210723
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Abcd2 A G 15: 91,188,973 Y328H probably benign Het
Abcg4 T C 9: 44,278,058 T381A probably benign Het
Adamts12 A G 15: 11,336,298 N1490D probably benign Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Armc8 G T 9: 99,527,131 C169* probably null Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bsn G A 9: 108,112,515 P2013S probably damaging Het
Cdc16 A G 8: 13,763,915 probably null Het
Cmtr1 T A 17: 29,690,342 F408L probably damaging Het
Col4a2 C T 8: 11,438,608 R1104W possibly damaging Het
Drg2 A C 11: 60,461,596 H208P probably damaging Het
Frem3 A T 8: 80,612,677 D533V probably damaging Het
Gm9930 T A 10: 9,534,593 noncoding transcript Het
Haus5 A G 7: 30,658,955 V305A possibly damaging Het
Hint3 C A 10: 30,618,249 R30L probably benign Het
Hltf T A 3: 20,098,067 probably null Het
Hmcn2 T A 2: 31,420,306 L3304Q probably benign Het
Hspa2 A G 12: 76,404,534 M1V probably null Het
Htr5b T C 1: 121,527,658 T178A possibly damaging Het
Ighv1-11 A G 12: 114,612,464 S44P probably damaging Het
Larp1b C T 3: 40,969,899 R104W probably damaging Het
Map3k2 A G 18: 32,228,136 T550A probably damaging Het
Map4 T A 9: 110,052,382 S105T possibly damaging Het
Mgam T C 6: 40,756,363 C691R probably damaging Het
Mms19 A G 19: 41,955,831 I310T possibly damaging Het
Myh2 A C 11: 67,180,875 K506T probably benign Het
Ngdn T C 14: 55,023,052 V239A probably benign Het
Plin1 G A 7: 79,725,712 R151* probably null Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rdh16f2 G T 10: 127,866,754 E67* probably null Het
Slc25a36 A C 9: 97,100,206 C25W probably damaging Het
Stk31 G A 6: 49,398,243 A49T probably damaging Het
Tigar T A 6: 127,089,204 T124S possibly damaging Het
Tsn A G 1: 118,304,713 V144A probably damaging Het
Zfp943 T A 17: 21,993,075 C381S probably damaging Het
Zfyve19 A T 2: 119,209,114 probably benign Het
Other mutations in Zfp703
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02441:Zfp703 APN 8 26980008 missense probably damaging 0.98
R1524:Zfp703 UTSW 8 26979373 missense probably damaging 1.00
R2082:Zfp703 UTSW 8 26978988 missense probably benign 0.01
R4049:Zfp703 UTSW 8 26979085 missense possibly damaging 0.70
R4570:Zfp703 UTSW 8 26978953 missense probably benign 0.10
R4884:Zfp703 UTSW 8 26978701 missense probably benign 0.03
R4929:Zfp703 UTSW 8 26978851 missense possibly damaging 0.66
R4938:Zfp703 UTSW 8 26979773 missense probably damaging 1.00
R4943:Zfp703 UTSW 8 26979591 missense probably benign 0.35
R5117:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5118:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5297:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5465:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5466:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5467:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5493:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5494:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5757:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5758:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5802:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5828:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5850:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5854:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5856:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R5959:Zfp703 UTSW 8 26979205 missense probably damaging 1.00
R6464:Zfp703 UTSW 8 26979327 missense probably damaging 1.00
R6867:Zfp703 UTSW 8 26978640 missense probably damaging 0.97
R7067:Zfp703 UTSW 8 26979016 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTCAGACTGCAAGAACGGC -3'
(R):5'- AGTAGGGGTCACGGCATAATCC -3'

Sequencing Primer
(F):5'- CCGGCGAACTGGACAAGAA -3'
(R):5'- GTCACGGCATAATCCCTGCAG -3'
Posted On2016-10-05