Incidental Mutation 'R5493:Eif2b3'
ID432165
Institutional Source Beutler Lab
Gene Symbol Eif2b3
Ensembl Gene ENSMUSG00000028683
Gene Nameeukaryotic translation initiation factor 2B, subunit 3
Synonyms1190002P15Rik
MMRRC Submission 043054-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5493 (G1)
Quality Score206
Status Validated
Chromosome4
Chromosomal Location117019402-117087306 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117086722 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 447 (D447G)
Ref Sequence ENSEMBL: ENSMUSP00000102056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070610] [ENSMUST00000106448]
Predicted Effect probably benign
Transcript: ENSMUST00000070610
SMART Domains Protein: ENSMUSP00000070334
Gene: ENSMUSG00000028683

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 8.2e-20 PFAM
Pfam:NTP_transf_3 5 226 8.5e-19 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106448
AA Change: D447G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102056
Gene: ENSMUSG00000028683
AA Change: D447G

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 140 3.2e-19 PFAM
Pfam:NTP_transf_3 5 237 3.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155181
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the subunits of initiation factor eIF2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. It has also been found to function as a cofactor of hepatitis C virus internal ribosome entry site-mediated translation. Mutations in this gene have been associated with leukodystrophy with vanishing white matter. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,243 S236P possibly damaging Het
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Agpat3 A G 10: 78,284,235 V155A possibly damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Aloxe3 A T 11: 69,128,617 R119* probably null Het
Asap1 A G 15: 64,130,151 V460A possibly damaging Het
Bicral C A 17: 46,801,694 R860L possibly damaging Het
Cd180 T A 13: 102,706,141 I565N probably benign Het
Cdk13 T C 13: 17,803,562 probably benign Het
Cdkn2d T C 9: 21,289,007 D156G probably benign Het
Clrn1 A G 3: 58,846,416 S175P probably damaging Het
Coro7 A G 16: 4,632,487 L535S probably damaging Het
Cse1l A G 2: 166,941,190 probably benign Het
Cyp2a12 T C 7: 27,029,125 L7P unknown Het
D130043K22Rik A G 13: 24,863,603 Y377C probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Duox2 T C 2: 122,281,496 Q1341R probably damaging Het
Fbxw25 T C 9: 109,652,916 Y234C probably benign Het
Gcnt2 A G 13: 40,953,600 N315S possibly damaging Het
Gm20730 A T 6: 43,081,812 V22E possibly damaging Het
Gm4847 T A 1: 166,630,321 I488F probably damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gmds A T 13: 31,940,505 M290K probably benign Het
Gtf3c1 T C 7: 125,670,544 N699S probably damaging Het
Hk3 A G 13: 55,011,171 V479A probably damaging Het
Ifnlr1 G A 4: 135,705,566 V438M probably benign Het
Il12rb1 C A 8: 70,809,839 P26T probably benign Het
Il4i1 G T 7: 44,840,053 R414L possibly damaging Het
Ipo4 T C 14: 55,630,870 N490S probably benign Het
Kcnmb2 A G 3: 32,198,142 E164G probably damaging Het
Kcns1 G A 2: 164,167,979 L287F probably benign Het
Kdm1a ACC AC 4: 136,557,421 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Knl1 T A 2: 119,068,730 I304K probably damaging Het
Ksr2 G T 5: 117,708,110 V681F probably damaging Het
Lypd2 T C 15: 74,734,278 T4A probably benign Het
Man1a A G 10: 54,074,480 V182A probably benign Het
Olfr1364 A T 13: 21,573,872 C195S probably damaging Het
Olfr504 T C 7: 108,565,567 D76G probably benign Het
Olfr533 A T 7: 140,466,807 D202V probably damaging Het
Olfr561 A T 7: 102,775,108 R195W probably benign Het
Olfr70 A G 4: 43,696,225 F316S possibly damaging Het
Pcdha2 C A 18: 36,939,509 F64L probably damaging Het
Pgap3 G C 11: 98,390,714 F168L possibly damaging Het
Pip5k1b T C 19: 24,439,075 N16S probably benign Het
Ppip5k1 T A 2: 121,336,772 H41L probably damaging Het
Ppp1r9a A G 6: 5,159,702 R1080G probably damaging Het
Qrich2 A C 11: 116,445,948 probably null Het
Rbl2 C T 8: 91,115,819 P1034L probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rin2 A G 2: 145,860,709 S442G probably damaging Het
Rtca C T 3: 116,499,631 R71Q probably benign Het
Serpind1 A T 16: 17,340,038 N366I probably damaging Het
Shox2 C G 3: 66,981,463 G32R probably damaging Het
Sp3 T A 2: 72,938,122 N766Y probably damaging Het
Spag7 T A 11: 70,669,233 S17C probably null Het
Stk25 A T 1: 93,635,309 F7I probably benign Het
Tbx15 G A 3: 99,352,564 G584S probably benign Het
Tenm2 T C 11: 36,864,676 D165G probably benign Het
Tox2 C A 2: 163,204,729 S42* probably null Het
Vmn1r39 A G 6: 66,804,770 V188A probably damaging Het
Zbtb5 A T 4: 44,993,941 M481K probably benign Het
Zfp26 T C 9: 20,444,319 T56A possibly damaging Het
Zfp459 C A 13: 67,408,379 C195F probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp764 A G 7: 127,404,933 I342T probably benign Het
Zfp942 T C 17: 21,933,004 N7D probably null Het
Other mutations in Eif2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Eif2b3 APN 4 117066469 missense probably benign
IGL01333:Eif2b3 APN 4 117070690 missense probably benign 0.31
IGL01564:Eif2b3 APN 4 117028542 missense probably benign 0.00
IGL01721:Eif2b3 APN 4 117058804 missense probably damaging 1.00
IGL02061:Eif2b3 APN 4 117028411 missense possibly damaging 0.78
R0835:Eif2b3 UTSW 4 117058805 missense probably damaging 1.00
R0924:Eif2b3 UTSW 4 117081578 missense possibly damaging 0.93
R2167:Eif2b3 UTSW 4 117028540 missense probably damaging 1.00
R2424:Eif2b3 UTSW 4 117070848 missense probably benign 0.01
R3902:Eif2b3 UTSW 4 117022207 missense probably damaging 1.00
R4105:Eif2b3 UTSW 4 117081634 missense probably damaging 1.00
R4688:Eif2b3 UTSW 4 117058849 missense probably benign 0.03
R4998:Eif2b3 UTSW 4 117066392 missense probably benign 0.06
R5033:Eif2b3 UTSW 4 117052736 missense probably damaging 1.00
R5123:Eif2b3 UTSW 4 117022211 missense probably damaging 1.00
R5787:Eif2b3 UTSW 4 117044440 missense probably damaging 1.00
R5789:Eif2b3 UTSW 4 117028495 missense probably damaging 1.00
R6347:Eif2b3 UTSW 4 117044566 missense probably benign 0.05
R6361:Eif2b3 UTSW 4 117028425 missense possibly damaging 0.66
R6643:Eif2b3 UTSW 4 117070757 missense probably damaging 0.97
R6798:Eif2b3 UTSW 4 117066458 missense probably benign 0.00
R7299:Eif2b3 UTSW 4 117052822 missense probably benign 0.27
R7301:Eif2b3 UTSW 4 117052822 missense probably benign 0.27
R7451:Eif2b3 UTSW 4 117052796 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGATATAGAGTCAGCTCCATCCTC -3'
(R):5'- ATGCTGTGAACGTGGGACTG -3'

Sequencing Primer
(F):5'- ATCCTCGTGCGGGAAGATG -3'
(R):5'- AAACCTAGGGCCTTGTGCATG -3'
Posted On2016-10-05