Incidental Mutation 'R5493:Gcnt2'
ID432199
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Nameglucosaminyl (N-acetyl) transferase 2, I-branching enzyme
SynonymsIGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik
MMRRC Submission 043054-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5493 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location40859754-40960892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40953600 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 315 (N315S)
Ref Sequence ENSEMBL: ENSMUSP00000066467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067778] [ENSMUST00000069958] [ENSMUST00000110191] [ENSMUST00000223570] [ENSMUST00000225759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067778
AA Change: N315S

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000066467
Gene: ENSMUSG00000021360
AA Change: N315S

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Branch 95 357 4.2e-58 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000069958
AA Change: N315S

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070942
Gene: ENSMUSG00000021360
AA Change: N315S

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Branch 95 357 8.4e-60 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110191
AA Change: N315S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360
AA Change: N315S

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153685
Predicted Effect possibly damaging
Transcript: ENSMUST00000223570
AA Change: N4S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223891
Predicted Effect probably benign
Transcript: ENSMUST00000225759
AA Change: N315S

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225996
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,243 S236P possibly damaging Het
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Agpat3 A G 10: 78,284,235 V155A possibly damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Aloxe3 A T 11: 69,128,617 R119* probably null Het
Asap1 A G 15: 64,130,151 V460A possibly damaging Het
Bicral C A 17: 46,801,694 R860L possibly damaging Het
Cd180 T A 13: 102,706,141 I565N probably benign Het
Cdk13 T C 13: 17,803,562 probably benign Het
Cdkn2d T C 9: 21,289,007 D156G probably benign Het
Clrn1 A G 3: 58,846,416 S175P probably damaging Het
Coro7 A G 16: 4,632,487 L535S probably damaging Het
Cse1l A G 2: 166,941,190 probably benign Het
Cyp2a12 T C 7: 27,029,125 L7P unknown Het
D130043K22Rik A G 13: 24,863,603 Y377C probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Duox2 T C 2: 122,281,496 Q1341R probably damaging Het
Eif2b3 A G 4: 117,086,722 D447G possibly damaging Het
Fbxw25 T C 9: 109,652,916 Y234C probably benign Het
Gm20730 A T 6: 43,081,812 V22E possibly damaging Het
Gm4847 T A 1: 166,630,321 I488F probably damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gmds A T 13: 31,940,505 M290K probably benign Het
Gtf3c1 T C 7: 125,670,544 N699S probably damaging Het
Hk3 A G 13: 55,011,171 V479A probably damaging Het
Ifnlr1 G A 4: 135,705,566 V438M probably benign Het
Il12rb1 C A 8: 70,809,839 P26T probably benign Het
Il4i1 G T 7: 44,840,053 R414L possibly damaging Het
Ipo4 T C 14: 55,630,870 N490S probably benign Het
Kcnmb2 A G 3: 32,198,142 E164G probably damaging Het
Kcns1 G A 2: 164,167,979 L287F probably benign Het
Kdm1a ACC AC 4: 136,557,421 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Knl1 T A 2: 119,068,730 I304K probably damaging Het
Ksr2 G T 5: 117,708,110 V681F probably damaging Het
Lypd2 T C 15: 74,734,278 T4A probably benign Het
Man1a A G 10: 54,074,480 V182A probably benign Het
Olfr1364 A T 13: 21,573,872 C195S probably damaging Het
Olfr504 T C 7: 108,565,567 D76G probably benign Het
Olfr533 A T 7: 140,466,807 D202V probably damaging Het
Olfr561 A T 7: 102,775,108 R195W probably benign Het
Olfr70 A G 4: 43,696,225 F316S possibly damaging Het
Pcdha2 C A 18: 36,939,509 F64L probably damaging Het
Pgap3 G C 11: 98,390,714 F168L possibly damaging Het
Pip5k1b T C 19: 24,439,075 N16S probably benign Het
Ppip5k1 T A 2: 121,336,772 H41L probably damaging Het
Ppp1r9a A G 6: 5,159,702 R1080G probably damaging Het
Qrich2 A C 11: 116,445,948 probably null Het
Rbl2 C T 8: 91,115,819 P1034L probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rin2 A G 2: 145,860,709 S442G probably damaging Het
Rtca C T 3: 116,499,631 R71Q probably benign Het
Serpind1 A T 16: 17,340,038 N366I probably damaging Het
Shox2 C G 3: 66,981,463 G32R probably damaging Het
Sp3 T A 2: 72,938,122 N766Y probably damaging Het
Spag7 T A 11: 70,669,233 S17C probably null Het
Stk25 A T 1: 93,635,309 F7I probably benign Het
Tbx15 G A 3: 99,352,564 G584S probably benign Het
Tenm2 T C 11: 36,864,676 D165G probably benign Het
Tox2 C A 2: 163,204,729 S42* probably null Het
Vmn1r39 A G 6: 66,804,770 V188A probably damaging Het
Zbtb5 A T 4: 44,993,941 M481K probably benign Het
Zfp26 T C 9: 20,444,319 T56A possibly damaging Het
Zfp459 C A 13: 67,408,379 C195F probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp764 A G 7: 127,404,933 I342T probably benign Het
Zfp942 T C 17: 21,933,004 N7D probably null Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 40887863 missense probably benign 0.06
IGL01693:Gcnt2 APN 13 40888073 missense probably benign
IGL02506:Gcnt2 APN 13 40887380 missense probably benign 0.02
IGL03184:Gcnt2 APN 13 40888184 missense probably benign 0.01
PIT4472001:Gcnt2 UTSW 13 40917937 missense probably benign 0.39
R0358:Gcnt2 UTSW 13 40860853 missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 40860521 missense probably benign 0.00
R1863:Gcnt2 UTSW 13 40861101 missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 40918606 missense probably benign 0.00
R3156:Gcnt2 UTSW 13 40861178 missense probably benign 0.36
R3893:Gcnt2 UTSW 13 40860446 missense probably benign 0.14
R4134:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4135:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 40888190 missense probably benign 0.17
R4422:Gcnt2 UTSW 13 40860525 nonsense probably null
R4599:Gcnt2 UTSW 13 40887490 missense probably benign
R4618:Gcnt2 UTSW 13 40958194 nonsense probably null
R4908:Gcnt2 UTSW 13 40860734 missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 40918355 missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 40918792 missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 40861176 missense probably damaging 1.00
R5463:Gcnt2 UTSW 13 40918174 missense possibly damaging 0.80
R5471:Gcnt2 UTSW 13 40860719 missense probably damaging 1.00
R5472:Gcnt2 UTSW 13 40953579 missense probably benign 0.30
R5586:Gcnt2 UTSW 13 40860953 missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 40918199 missense probably benign 0.03
R6244:Gcnt2 UTSW 13 40861241 missense probably damaging 1.00
R6293:Gcnt2 UTSW 13 40918697 missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 40887556 frame shift probably null
R7077:Gcnt2 UTSW 13 40860420 missense probably benign
R7432:Gcnt2 UTSW 13 40887212 intron probably benign
R7474:Gcnt2 UTSW 13 40958257 missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 40887681 missense probably benign 0.02
Z1088:Gcnt2 UTSW 13 40918639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGATGCGTGGAGACTGC -3'
(R):5'- TTTCTCTGAGCACAGGAGC -3'

Sequencing Primer
(F):5'- GCTCAACTAGGACAGTGATGCTTC -3'
(R):5'- GGAGCACAAGAACCTCTTTTACTGAG -3'
Posted On2016-10-05