Incidental Mutation 'R5493:Asap1'
ID432205
Institutional Source Beutler Lab
Gene Symbol Asap1
Ensembl Gene ENSMUSG00000022377
Gene NameArfGAP with SH3 domain, ankyrin repeat and PH domain1
SynonymsDdef1, mKIAA1249
MMRRC Submission 043054-MU
Accession Numbers

Genbank: NM_010026; MGI: 1342335

Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R5493 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location64086857-64382919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64130151 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 460 (V460A)
Ref Sequence ENSEMBL: ENSMUSP00000134825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023008] [ENSMUST00000110114] [ENSMUST00000110115] [ENSMUST00000175793] [ENSMUST00000175799] [ENSMUST00000176014] [ENSMUST00000176384] [ENSMUST00000177035] [ENSMUST00000177083] [ENSMUST00000177371] [ENSMUST00000177374]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023008
AA Change: V460A

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023008
Gene: ENSMUSG00000022377
AA Change: V460A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 814 847 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
low complexity region 892 903 N/A INTRINSIC
low complexity region 971 984 N/A INTRINSIC
low complexity region 1065 1077 N/A INTRINSIC
SH3 1088 1146 3.29e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110114
AA Change: V460A

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105741
Gene: ENSMUSG00000022377
AA Change: V460A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 835 846 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
SH3 1031 1089 3.29e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110115
AA Change: V445A

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105742
Gene: ENSMUSG00000022377
AA Change: V445A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 325 418 4.12e-15 SMART
ArfGap 439 562 2.18e-34 SMART
ANK 600 632 1.17e-1 SMART
ANK 636 665 3.46e-4 SMART
low complexity region 712 723 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 799 832 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 956 969 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
SH3 1073 1131 3.29e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000175793
AA Change: V448A

PolyPhen 2 Score 0.765 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135718
Gene: ENSMUSG00000022377
AA Change: V448A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 328 421 4.12e-15 SMART
ArfGap 442 565 2.18e-34 SMART
ANK 603 635 1.17e-1 SMART
ANK 639 668 3.46e-4 SMART
low complexity region 715 726 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 802 835 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 959 972 N/A INTRINSIC
low complexity region 1053 1065 N/A INTRINSIC
SH3 1076 1134 3.29e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000175799
AA Change: V457A

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135359
Gene: ENSMUSG00000022377
AA Change: V457A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 337 430 4.12e-15 SMART
ArfGap 451 574 2.18e-34 SMART
ANK 612 644 1.17e-1 SMART
ANK 648 677 3.46e-4 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 789 800 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 911 924 N/A INTRINSIC
low complexity region 1005 1017 N/A INTRINSIC
SH3 1028 1086 3.29e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176014
AA Change: V457A

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135172
Gene: ENSMUSG00000022377
AA Change: V457A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 337 430 4.12e-15 SMART
ArfGap 451 574 2.18e-34 SMART
ANK 612 644 1.17e-1 SMART
ANK 648 677 3.46e-4 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 789 800 N/A INTRINSIC
low complexity region 811 844 N/A INTRINSIC
low complexity region 853 862 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 968 981 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
SH3 1085 1143 3.29e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176384
AA Change: V460A

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135190
Gene: ENSMUSG00000022377
AA Change: V460A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 310 328 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 835 846 N/A INTRINSIC
low complexity region 914 927 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
SH3 1031 1089 3.29e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177035
AA Change: V445A

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135346
Gene: ENSMUSG00000022377
AA Change: V445A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
PH 325 418 4.12e-15 SMART
ArfGap 439 562 2.18e-34 SMART
ANK 600 632 1.17e-1 SMART
ANK 636 665 3.46e-4 SMART
low complexity region 712 723 N/A INTRINSIC
low complexity region 777 788 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 899 912 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
SH3 1016 1074 3.29e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177083
AA Change: V425A

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134877
Gene: ENSMUSG00000022377
AA Change: V425A

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
PH 305 398 4.12e-15 SMART
ArfGap 419 542 2.18e-34 SMART
ANK 580 612 1.17e-1 SMART
ANK 616 645 3.46e-4 SMART
low complexity region 692 703 N/A INTRINSIC
low complexity region 757 768 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 821 830 N/A INTRINSIC
low complexity region 857 868 N/A INTRINSIC
low complexity region 936 949 N/A INTRINSIC
low complexity region 1030 1042 N/A INTRINSIC
SH3 1053 1111 3.29e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177371
AA Change: V437A

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135643
Gene: ENSMUSG00000022377
AA Change: V437A

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
PH 317 410 4.12e-15 SMART
ArfGap 431 554 2.18e-34 SMART
ANK 592 624 1.17e-1 SMART
ANK 628 657 3.46e-4 SMART
low complexity region 704 715 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 791 824 N/A INTRINSIC
low complexity region 833 842 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1042 1054 N/A INTRINSIC
SH3 1065 1123 3.29e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177374
AA Change: V460A

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134825
Gene: ENSMUSG00000022377
AA Change: V460A

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:BAR 18 267 1.8e-11 PFAM
Pfam:BAR_3 52 286 1.2e-29 PFAM
low complexity region 310 328 N/A INTRINSIC
PH 340 433 4.12e-15 SMART
ArfGap 454 577 2.18e-34 SMART
ANK 615 647 1.17e-1 SMART
ANK 651 680 3.46e-4 SMART
low complexity region 727 738 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 814 847 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
low complexity region 892 903 N/A INTRINSIC
low complexity region 971 984 N/A INTRINSIC
low complexity region 1065 1077 N/A INTRINSIC
SH3 1088 1146 3.29e-17 SMART
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ADP-ribosylation factor (ARF) GTPase-activating protein. The GTPase-activating activity is stimulated by phosphatidylinositol 4,5-biphosphate (PIP2), and is greater towards ARF1 and ARF5, and lesser for ARF6. This gene maybe involved in regulation of membrane trafficking and cytoskeleton remodeling. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI

All alleles(13) : Gene trapped(13)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,243 S236P possibly damaging Het
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Agpat3 A G 10: 78,284,235 V155A possibly damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Aloxe3 A T 11: 69,128,617 R119* probably null Het
Bicral C A 17: 46,801,694 R860L possibly damaging Het
Cd180 T A 13: 102,706,141 I565N probably benign Het
Cdk13 T C 13: 17,803,562 probably benign Het
Cdkn2d T C 9: 21,289,007 D156G probably benign Het
Clrn1 A G 3: 58,846,416 S175P probably damaging Het
Coro7 A G 16: 4,632,487 L535S probably damaging Het
Cse1l A G 2: 166,941,190 probably benign Het
Cyp2a12 T C 7: 27,029,125 L7P unknown Het
D130043K22Rik A G 13: 24,863,603 Y377C probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Duox2 T C 2: 122,281,496 Q1341R probably damaging Het
Eif2b3 A G 4: 117,086,722 D447G possibly damaging Het
Fbxw25 T C 9: 109,652,916 Y234C probably benign Het
Gcnt2 A G 13: 40,953,600 N315S possibly damaging Het
Gm20730 A T 6: 43,081,812 V22E possibly damaging Het
Gm4847 T A 1: 166,630,321 I488F probably damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gmds A T 13: 31,940,505 M290K probably benign Het
Gtf3c1 T C 7: 125,670,544 N699S probably damaging Het
Hk3 A G 13: 55,011,171 V479A probably damaging Het
Ifnlr1 G A 4: 135,705,566 V438M probably benign Het
Il12rb1 C A 8: 70,809,839 P26T probably benign Het
Il4i1 G T 7: 44,840,053 R414L possibly damaging Het
Ipo4 T C 14: 55,630,870 N490S probably benign Het
Kcnmb2 A G 3: 32,198,142 E164G probably damaging Het
Kcns1 G A 2: 164,167,979 L287F probably benign Het
Kdm1a ACC AC 4: 136,557,421 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Knl1 T A 2: 119,068,730 I304K probably damaging Het
Ksr2 G T 5: 117,708,110 V681F probably damaging Het
Lypd2 T C 15: 74,734,278 T4A probably benign Het
Man1a A G 10: 54,074,480 V182A probably benign Het
Olfr1364 A T 13: 21,573,872 C195S probably damaging Het
Olfr504 T C 7: 108,565,567 D76G probably benign Het
Olfr533 A T 7: 140,466,807 D202V probably damaging Het
Olfr561 A T 7: 102,775,108 R195W probably benign Het
Olfr70 A G 4: 43,696,225 F316S possibly damaging Het
Pcdha2 C A 18: 36,939,509 F64L probably damaging Het
Pgap3 G C 11: 98,390,714 F168L possibly damaging Het
Pip5k1b T C 19: 24,439,075 N16S probably benign Het
Ppip5k1 T A 2: 121,336,772 H41L probably damaging Het
Ppp1r9a A G 6: 5,159,702 R1080G probably damaging Het
Qrich2 A C 11: 116,445,948 probably null Het
Rbl2 C T 8: 91,115,819 P1034L probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rin2 A G 2: 145,860,709 S442G probably damaging Het
Rtca C T 3: 116,499,631 R71Q probably benign Het
Serpind1 A T 16: 17,340,038 N366I probably damaging Het
Shox2 C G 3: 66,981,463 G32R probably damaging Het
Sp3 T A 2: 72,938,122 N766Y probably damaging Het
Spag7 T A 11: 70,669,233 S17C probably null Het
Stk25 A T 1: 93,635,309 F7I probably benign Het
Tbx15 G A 3: 99,352,564 G584S probably benign Het
Tenm2 T C 11: 36,864,676 D165G probably benign Het
Tox2 C A 2: 163,204,729 S42* probably null Het
Vmn1r39 A G 6: 66,804,770 V188A probably damaging Het
Zbtb5 A T 4: 44,993,941 M481K probably benign Het
Zfp26 T C 9: 20,444,319 T56A possibly damaging Het
Zfp459 C A 13: 67,408,379 C195F probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp764 A G 7: 127,404,933 I342T probably benign Het
Zfp942 T C 17: 21,933,004 N7D probably null Het
Other mutations in Asap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Asap1 APN 15 64119954 splice site probably benign
IGL00473:Asap1 APN 15 64173215 splice site probably benign
IGL00519:Asap1 APN 15 64110942 missense probably damaging 1.00
IGL01304:Asap1 APN 15 64312449 missense probably damaging 1.00
IGL01510:Asap1 APN 15 64158928 missense probably damaging 1.00
IGL02208:Asap1 APN 15 64122033 missense probably damaging 1.00
IGL02338:Asap1 APN 15 64123670 critical splice donor site probably null
IGL02429:Asap1 APN 15 64167740 missense probably damaging 1.00
IGL02565:Asap1 APN 15 64129165 splice site probably benign
IGL02644:Asap1 APN 15 64111062 missense probably damaging 1.00
IGL02684:Asap1 APN 15 64094169 missense probably benign
IGL02707:Asap1 APN 15 64129274 missense probably damaging 1.00
IGL03052:Asap1 APN 15 64153834 splice site probably benign
IGL03153:Asap1 APN 15 64160274 missense probably damaging 1.00
A4554:Asap1 UTSW 15 64124711 splice site probably benign
PIT4378001:Asap1 UTSW 15 64135848 missense probably damaging 0.99
R0081:Asap1 UTSW 15 64099564 missense probably damaging 1.00
R0555:Asap1 UTSW 15 64094364 missense probably damaging 1.00
R1414:Asap1 UTSW 15 64158884 missense possibly damaging 0.92
R1437:Asap1 UTSW 15 64120107 missense probably damaging 0.96
R1474:Asap1 UTSW 15 64120020 missense probably benign 0.01
R1489:Asap1 UTSW 15 64172730 missense probably damaging 1.00
R1553:Asap1 UTSW 15 64152852 missense probably benign 0.31
R1603:Asap1 UTSW 15 64129257 missense probably damaging 1.00
R1636:Asap1 UTSW 15 64123912 missense probably damaging 1.00
R1645:Asap1 UTSW 15 64089475 missense probably damaging 0.99
R1861:Asap1 UTSW 15 64135798 splice site probably benign
R2136:Asap1 UTSW 15 64110959 missense probably damaging 1.00
R2351:Asap1 UTSW 15 64135804 critical splice donor site probably null
R4436:Asap1 UTSW 15 64349843 missense probably benign 0.03
R4618:Asap1 UTSW 15 64152895 missense probably damaging 1.00
R4868:Asap1 UTSW 15 64094181 missense probably benign
R5077:Asap1 UTSW 15 64127423 missense probably damaging 1.00
R5333:Asap1 UTSW 15 64127414 missense possibly damaging 0.79
R5391:Asap1 UTSW 15 64094052 missense possibly damaging 0.57
R5665:Asap1 UTSW 15 64312453 missense probably damaging 1.00
R5756:Asap1 UTSW 15 64167707 missense probably damaging 1.00
R5790:Asap1 UTSW 15 64094265 missense probably damaging 1.00
R6139:Asap1 UTSW 15 64166539 missense possibly damaging 0.87
R6194:Asap1 UTSW 15 64129209 missense probably damaging 1.00
R6361:Asap1 UTSW 15 64349823 splice site probably null
R6751:Asap1 UTSW 15 64094412 missense possibly damaging 0.86
R7143:Asap1 UTSW 15 64191528 missense probably damaging 1.00
R7218:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7225:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7305:Asap1 UTSW 15 64130250 missense probably damaging 1.00
R7310:Asap1 UTSW 15 64099530 critical splice donor site probably null
R7439:Asap1 UTSW 15 64130256 missense probably damaging 1.00
R7441:Asap1 UTSW 15 64130256 missense probably damaging 1.00
R7488:Asap1 UTSW 15 64120125 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGAGGGGAATCTTCATGCTCAG -3'
(R):5'- GAGAGGGCTTTTGAAAGTTCC -3'

Sequencing Primer
(F):5'- GGGAATCTTCATGCTCAGAGATC -3'
(R):5'- CCTATTGAAGATATGTTTCCAGTGG -3'
Posted On2016-10-05