Incidental Mutation 'R5493:Pcdha2'
ID432213
Institutional Source Beutler Lab
Gene Symbol Pcdha2
Ensembl Gene ENSMUSG00000104148
Gene Nameprotocadherin alpha 2
Synonyms
MMRRC Submission 043054-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R5493 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36939205-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36939509 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 64 (F64L)
Ref Sequence ENSEMBL: ENSMUSP00000111326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115662] [ENSMUST00000193839] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115662
AA Change: F64L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148
AA Change: F64L

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192440
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195590
AA Change: F64L

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148
AA Change: F64L

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.4%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik A G 16: 21,653,243 S236P possibly damaging Het
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Agpat3 A G 10: 78,284,235 V155A possibly damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Aloxe3 A T 11: 69,128,617 R119* probably null Het
Asap1 A G 15: 64,130,151 V460A possibly damaging Het
Bicral C A 17: 46,801,694 R860L possibly damaging Het
Cd180 T A 13: 102,706,141 I565N probably benign Het
Cdk13 T C 13: 17,803,562 probably benign Het
Cdkn2d T C 9: 21,289,007 D156G probably benign Het
Clrn1 A G 3: 58,846,416 S175P probably damaging Het
Coro7 A G 16: 4,632,487 L535S probably damaging Het
Cse1l A G 2: 166,941,190 probably benign Het
Cyp2a12 T C 7: 27,029,125 L7P unknown Het
D130043K22Rik A G 13: 24,863,603 Y377C probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Duox2 T C 2: 122,281,496 Q1341R probably damaging Het
Eif2b3 A G 4: 117,086,722 D447G possibly damaging Het
Fbxw25 T C 9: 109,652,916 Y234C probably benign Het
Gcnt2 A G 13: 40,953,600 N315S possibly damaging Het
Gm20730 A T 6: 43,081,812 V22E possibly damaging Het
Gm4847 T A 1: 166,630,321 I488F probably damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gmds A T 13: 31,940,505 M290K probably benign Het
Gtf3c1 T C 7: 125,670,544 N699S probably damaging Het
Hk3 A G 13: 55,011,171 V479A probably damaging Het
Ifnlr1 G A 4: 135,705,566 V438M probably benign Het
Il12rb1 C A 8: 70,809,839 P26T probably benign Het
Il4i1 G T 7: 44,840,053 R414L possibly damaging Het
Ipo4 T C 14: 55,630,870 N490S probably benign Het
Kcnmb2 A G 3: 32,198,142 E164G probably damaging Het
Kcns1 G A 2: 164,167,979 L287F probably benign Het
Kdm1a ACC AC 4: 136,557,421 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Knl1 T A 2: 119,068,730 I304K probably damaging Het
Ksr2 G T 5: 117,708,110 V681F probably damaging Het
Lypd2 T C 15: 74,734,278 T4A probably benign Het
Man1a A G 10: 54,074,480 V182A probably benign Het
Olfr1364 A T 13: 21,573,872 C195S probably damaging Het
Olfr504 T C 7: 108,565,567 D76G probably benign Het
Olfr533 A T 7: 140,466,807 D202V probably damaging Het
Olfr561 A T 7: 102,775,108 R195W probably benign Het
Olfr70 A G 4: 43,696,225 F316S possibly damaging Het
Pgap3 G C 11: 98,390,714 F168L possibly damaging Het
Pip5k1b T C 19: 24,439,075 N16S probably benign Het
Ppip5k1 T A 2: 121,336,772 H41L probably damaging Het
Ppp1r9a A G 6: 5,159,702 R1080G probably damaging Het
Qrich2 A C 11: 116,445,948 probably null Het
Rbl2 C T 8: 91,115,819 P1034L probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rin2 A G 2: 145,860,709 S442G probably damaging Het
Rtca C T 3: 116,499,631 R71Q probably benign Het
Serpind1 A T 16: 17,340,038 N366I probably damaging Het
Shox2 C G 3: 66,981,463 G32R probably damaging Het
Sp3 T A 2: 72,938,122 N766Y probably damaging Het
Spag7 T A 11: 70,669,233 S17C probably null Het
Stk25 A T 1: 93,635,309 F7I probably benign Het
Tbx15 G A 3: 99,352,564 G584S probably benign Het
Tenm2 T C 11: 36,864,676 D165G probably benign Het
Tox2 C A 2: 163,204,729 S42* probably null Het
Vmn1r39 A G 6: 66,804,770 V188A probably damaging Het
Zbtb5 A T 4: 44,993,941 M481K probably benign Het
Zfp26 T C 9: 20,444,319 T56A possibly damaging Het
Zfp459 C A 13: 67,408,379 C195F probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp764 A G 7: 127,404,933 I342T probably benign Het
Zfp942 T C 17: 21,933,004 N7D probably null Het
Other mutations in Pcdha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03052:Pcdha2 UTSW 18 36941617 missense probably damaging 1.00
R3157:Pcdha2 UTSW 18 36940092 missense probably damaging 1.00
R3159:Pcdha2 UTSW 18 36941197 missense probably damaging 1.00
R3806:Pcdha2 UTSW 18 36939529 missense probably benign 0.02
R3806:Pcdha2 UTSW 18 36941691 nonsense probably null
R3815:Pcdha2 UTSW 18 36941695 missense probably benign
R3816:Pcdha2 UTSW 18 36941695 missense probably benign
R3937:Pcdha2 UTSW 18 36941323 missense probably benign 0.42
R3970:Pcdha2 UTSW 18 36940697 nonsense probably null
R4058:Pcdha2 UTSW 18 36939882 missense probably benign 0.07
R4059:Pcdha2 UTSW 18 36939882 missense probably benign 0.07
R4179:Pcdha2 UTSW 18 36941476 missense probably damaging 1.00
R4457:Pcdha2 UTSW 18 36940546 missense probably damaging 1.00
R4724:Pcdha2 UTSW 18 36940515 missense possibly damaging 0.88
R4812:Pcdha2 UTSW 18 36939808 missense probably benign
R4884:Pcdha2 UTSW 18 36940900 missense probably damaging 1.00
R5130:Pcdha2 UTSW 18 36940669 missense probably damaging 1.00
R5223:Pcdha2 UTSW 18 36940791 missense probably damaging 1.00
R5442:Pcdha2 UTSW 18 36939862 missense probably benign 0.14
R5460:Pcdha2 UTSW 18 36939421 missense probably damaging 1.00
R5946:Pcdha2 UTSW 18 36941106 missense probably damaging 0.96
R6054:Pcdha2 UTSW 18 36940804 missense probably damaging 1.00
R7378:Pcdha2 UTSW 18 36939385 missense possibly damaging 0.88
R7465:Pcdha2 UTSW 18 36940330 missense probably damaging 1.00
R7542:Pcdha2 UTSW 18 36940089 missense probably damaging 0.99
Z1088:Pcdha2 UTSW 18 36941121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTAGAAGTGATGCCTTCTTTG -3'
(R):5'- CGGGTTGTCGTTAATGTCCC -3'

Sequencing Primer
(F):5'- CTAGAAGTGATGCCTTCTTTGAGAGG -3'
(R):5'- GGTTGTCGTTAATGTCCCTCACC -3'
Posted On2016-10-05