Incidental Mutation 'R5494:Hc'
ID432219
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Namehemolytic complement
SynonymsHe, C5, C5a
MMRRC Submission 043055-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R5494 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location34983331-35061438 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 35003539 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
PDB Structure
Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000028233
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153559
Predicted Effect probably benign
Transcript: ENSMUST00000156412
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,347,169 E436G probably damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Apob A G 12: 8,011,762 N3415D probably damaging Het
Asb18 T C 1: 89,954,399 E139G probably damaging Het
Atrn T C 2: 131,023,075 L1374P probably damaging Het
Ccdc81 A G 7: 89,877,573 S410P probably damaging Het
Cep112 A G 11: 108,664,605 E809G probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Ddn C A 15: 98,807,003 R82L probably damaging Het
Dgkz A T 2: 91,941,049 probably null Het
Frem1 T C 4: 82,940,753 *415W probably null Het
Fry A T 5: 150,390,667 D789V probably damaging Het
Fzr1 C T 10: 81,371,344 probably null Het
Gemin5 T A 11: 58,130,700 Y1025F probably damaging Het
Gjb5 C T 4: 127,355,554 V266M probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Golgb1 T A 16: 36,928,683 N3056K possibly damaging Het
Gucy1b1 T A 3: 82,039,876 D342V probably damaging Het
Heg1 A G 16: 33,725,434 D185G probably benign Het
Hils1 T C 11: 94,968,017 L46S probably benign Het
Igf2r A T 17: 12,693,145 M1865K possibly damaging Het
Il27 A G 7: 126,592,928 L12P probably damaging Het
Krt1 C T 15: 101,850,714 C5Y unknown Het
Med25 C T 7: 44,885,801 V170M probably damaging Het
Mgat4a T A 1: 37,454,817 Y316F probably damaging Het
Oas3 A G 5: 120,761,644 V725A unknown Het
Olfr1140 T C 2: 87,746,606 S137P probably damaging Het
Olfr655 C A 7: 104,596,725 G152V probably damaging Het
Pcdhb17 T C 18: 37,487,247 S697P probably damaging Het
Plch2 T C 4: 154,991,122 Y751C probably damaging Het
Rbms2 G T 10: 128,137,691 T252N probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Scfd1 A G 12: 51,396,739 probably null Het
Shank3 C T 15: 89,548,238 T1062M probably damaging Het
Slc28a1 G A 7: 81,168,039 G552E probably damaging Het
Sntn A G 14: 13,682,214 R96G probably benign Het
Tas2r102 T C 6: 132,763,143 V338A probably benign Het
Trim62 A T 4: 128,885,206 N145Y possibly damaging Het
Tspoap1 C T 11: 87,775,205 T863I possibly damaging Het
Ubr5 C T 15: 38,019,281 C739Y possibly damaging Het
Vps13c G A 9: 67,948,146 V2498I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4142001:Hc UTSW 2 35031821 splice site probably benign
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0025:Hc UTSW 2 34986292 missense probably damaging 1.00
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0242:Hc UTSW 2 35036154 splice site probably benign
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1610:Hc UTSW 2 35006161 missense probably benign 0.44
R1640:Hc UTSW 2 35057324 nonsense probably null
R1887:Hc UTSW 2 35034611 missense probably benign
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2019:Hc UTSW 2 35013528 missense probably damaging 1.00
R2151:Hc UTSW 2 34991103 intron probably benign
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5032:Hc UTSW 2 35013532 missense probably benign 0.07
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5450:Hc UTSW 2 35013038 missense possibly damaging 0.67
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 intron probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTACCTGGGTGGAATAAAAGCCG -3'
(R):5'- TGCTCCACTGTCAGACCATG -3'

Sequencing Primer
(F):5'- CTCTTCAGATAGCCACTTGATGATGG -3'
(R):5'- GTGTGGCCATCCTTCTACAATGG -3'
Posted On2016-10-05