Incidental Mutation 'R5494:Gli3'
ID432255
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene NameGLI-Kruppel family member GLI3
Synonymsbrachyphalangy, Bph
MMRRC Submission 043055-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5494 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location15463235-15730026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15725982 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1318 (Q1318L)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510]
Predicted Effect probably benign
Transcript: ENSMUST00000110510
AA Change: Q1318L

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: Q1318L

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A G 10: 41,347,169 E436G probably damaging Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Apob A G 12: 8,011,762 N3415D probably damaging Het
Asb18 T C 1: 89,954,399 E139G probably damaging Het
Atrn T C 2: 131,023,075 L1374P probably damaging Het
Ccdc81 A G 7: 89,877,573 S410P probably damaging Het
Cep112 A G 11: 108,664,605 E809G probably damaging Het
Dctn1 G T 6: 83,182,564 R8L possibly damaging Het
Ddn C A 15: 98,807,003 R82L probably damaging Het
Dgkz A T 2: 91,941,049 probably null Het
Frem1 T C 4: 82,940,753 *415W probably null Het
Fry A T 5: 150,390,667 D789V probably damaging Het
Fzr1 C T 10: 81,371,344 probably null Het
Gemin5 T A 11: 58,130,700 Y1025F probably damaging Het
Gjb5 C T 4: 127,355,554 V266M probably damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Golgb1 T A 16: 36,928,683 N3056K possibly damaging Het
Gucy1b1 T A 3: 82,039,876 D342V probably damaging Het
Hc A T 2: 35,003,539 probably null Het
Heg1 A G 16: 33,725,434 D185G probably benign Het
Hils1 T C 11: 94,968,017 L46S probably benign Het
Igf2r A T 17: 12,693,145 M1865K possibly damaging Het
Il27 A G 7: 126,592,928 L12P probably damaging Het
Krt1 C T 15: 101,850,714 C5Y unknown Het
Med25 C T 7: 44,885,801 V170M probably damaging Het
Mgat4a T A 1: 37,454,817 Y316F probably damaging Het
Oas3 A G 5: 120,761,644 V725A unknown Het
Olfr1140 T C 2: 87,746,606 S137P probably damaging Het
Olfr655 C A 7: 104,596,725 G152V probably damaging Het
Pcdhb17 T C 18: 37,487,247 S697P probably damaging Het
Plch2 T C 4: 154,991,122 Y751C probably damaging Het
Rbms2 G T 10: 128,137,691 T252N probably damaging Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Scfd1 A G 12: 51,396,739 probably null Het
Shank3 C T 15: 89,548,238 T1062M probably damaging Het
Slc28a1 G A 7: 81,168,039 G552E probably damaging Het
Sntn A G 14: 13,682,214 R96G probably benign Het
Tas2r102 T C 6: 132,763,143 V338A probably benign Het
Trim62 A T 4: 128,885,206 N145Y possibly damaging Het
Tspoap1 C T 11: 87,775,205 T863I possibly damaging Het
Ubr5 C T 15: 38,019,281 C739Y possibly damaging Het
Vps13c G A 9: 67,948,146 V2498I probably benign Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15644299 missense probably damaging 1.00
IGL00471:Gli3 APN 13 15723769 critical splice donor site probably null
IGL00484:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15644392 missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15548398 critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15648634 missense probably damaging 1.00
IGL01799:Gli3 APN 13 15726161 missense probably benign 0.00
IGL01861:Gli3 APN 13 15725325 missense probably damaging 1.00
IGL02063:Gli3 APN 13 15726372 missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15662514 missense probably damaging 1.00
IGL02255:Gli3 APN 13 15648719 missense probably damaging 1.00
IGL02270:Gli3 APN 13 15726786 utr 3 prime probably benign
IGL02336:Gli3 APN 13 15720289 missense probably damaging 1.00
IGL02346:Gli3 APN 13 15723693 missense probably damaging 1.00
IGL02744:Gli3 APN 13 15613886 critical splice donor site probably null
IGL02877:Gli3 APN 13 15724742 missense probably damaging 1.00
IGL02975:Gli3 APN 13 15724568 missense probably damaging 1.00
IGL03018:Gli3 APN 13 15660132 missense probably damaging 1.00
IGL03378:Gli3 APN 13 15644420 missense probably damaging 1.00
IGL03406:Gli3 APN 13 15648581 missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15644357 missense probably damaging 1.00
R0110:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0329:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0330:Gli3 UTSW 13 15723558 missense probably damaging 0.98
R0360:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0364:Gli3 UTSW 13 15724764 missense probably benign 0.32
R0469:Gli3 UTSW 13 15724785 missense probably damaging 1.00
R0616:Gli3 UTSW 13 15662406 missense possibly damaging 0.75
R0639:Gli3 UTSW 13 15724715 missense probably damaging 1.00
R1072:Gli3 UTSW 13 15713605 missense probably damaging 1.00
R1257:Gli3 UTSW 13 15725996 nonsense probably null
R1270:Gli3 UTSW 13 15723744 missense probably benign 0.02
R1424:Gli3 UTSW 13 15726314 missense probably benign 0.00
R1481:Gli3 UTSW 13 15613850 missense probably damaging 0.99
R1596:Gli3 UTSW 13 15725471 missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15726312 missense probably benign 0.00
R1721:Gli3 UTSW 13 15726297 missense probably benign 0.27
R1797:Gli3 UTSW 13 15713512 missense probably damaging 0.99
R1813:Gli3 UTSW 13 15648691 missense probably damaging 1.00
R1819:Gli3 UTSW 13 15725792 nonsense probably null
R1988:Gli3 UTSW 13 15726380 missense probably benign
R2132:Gli3 UTSW 13 15725549 missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15662392 missense probably benign 0.02
R3085:Gli3 UTSW 13 15660941 missense probably damaging 1.00
R3177:Gli3 UTSW 13 15725982 missense probably benign 0.28
R3277:Gli3 UTSW 13 15725982 missense probably benign 0.28
R4162:Gli3 UTSW 13 15725115 missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15723571 missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15713631 missense probably damaging 1.00
R4979:Gli3 UTSW 13 15724464 missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15548507 missense probably damaging 0.99
R5395:Gli3 UTSW 13 15714950 missense probably damaging 1.00
R5609:Gli3 UTSW 13 15548453 missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15478165 critical splice donor site probably null
R5810:Gli3 UTSW 13 15644309 missense probably damaging 0.99
R5896:Gli3 UTSW 13 15726180 missense probably benign 0.00
R5930:Gli3 UTSW 13 15548625 missense probably damaging 1.00
R5964:Gli3 UTSW 13 15726162 nonsense probably null
R5985:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6224:Gli3 UTSW 13 15725145 missense probably benign
R6278:Gli3 UTSW 13 15725113 missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15724732 missense probably damaging 1.00
R6383:Gli3 UTSW 13 15723555 missense probably damaging 1.00
R6523:Gli3 UTSW 13 15713650 critical splice donor site probably null
R7072:Gli3 UTSW 13 15725695 missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15715062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGAACAGCCCTTTAAGAC -3'
(R):5'- TGATAGCTGCCATGCTTGATG -3'

Sequencing Primer
(F):5'- CCTTTAAGACCCAGCAGTATGG -3'
(R):5'- CCATGCTTGATGGCTGGC -3'
Posted On2016-10-05