Incidental Mutation 'R5496:Zfp850'
ID432346
Institutional Source Beutler Lab
Gene Symbol Zfp850
Ensembl Gene ENSMUSG00000096916
Gene Namezinc finger protein 850
SynonymsC130069I09Rik, Gm4636
MMRRC Submission 043057-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5496 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27984854-28014115 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 28007346 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 43 (M43R)
Ref Sequence ENSEMBL: ENSMUSP00000141063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180024] [ENSMUST00000180502]
Predicted Effect probably damaging
Transcript: ENSMUST00000180024
AA Change: M43R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137192
Gene: ENSMUSG00000096916
AA Change: M43R

DomainStartEndE-ValueType
KRAB 14 75 1.56e-34 SMART
ZnF_C2H2 172 194 7.18e1 SMART
ZnF_C2H2 200 222 3.63e-3 SMART
ZnF_C2H2 228 250 8.94e-3 SMART
ZnF_C2H2 256 278 7.49e-5 SMART
ZnF_C2H2 313 335 1.01e-1 SMART
ZnF_C2H2 341 363 4.4e-2 SMART
ZnF_C2H2 369 391 7.37e-4 SMART
ZnF_C2H2 397 419 8.47e-4 SMART
ZnF_C2H2 425 447 1.92e-2 SMART
ZnF_C2H2 453 475 2.99e-4 SMART
ZnF_C2H2 481 503 7.78e-3 SMART
ZnF_C2H2 509 531 1.95e-3 SMART
ZnF_C2H2 537 559 1.92e-2 SMART
ZnF_C2H2 565 587 2.99e-4 SMART
ZnF_C2H2 593 615 1.79e-2 SMART
ZnF_C2H2 621 643 7.37e-4 SMART
ZnF_C2H2 649 671 4.4e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180502
AA Change: M43R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141063
Gene: ENSMUSG00000096916
AA Change: M43R

DomainStartEndE-ValueType
KRAB 14 75 6.5e-37 SMART
ZnF_C2H2 172 194 3e-1 SMART
ZnF_C2H2 200 222 1.5e-5 SMART
ZnF_C2H2 228 250 3.8e-5 SMART
ZnF_C2H2 256 274 2.5e-1 SMART
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,674,818 V84I probably benign Het
Adam10 T G 9: 70,722,739 F151C probably damaging Het
Akap6 A G 12: 53,140,653 S1617G possibly damaging Het
Ano6 T A 15: 95,967,614 probably null Het
Atmin A G 8: 116,957,172 T524A probably benign Het
Bicra C T 7: 15,987,841 V584I probably benign Het
Carmil1 G A 13: 24,155,450 R54C probably damaging Het
Cbln1 A G 8: 87,471,696 I127T possibly damaging Het
Ccl26 A G 5: 135,563,363 V40A probably benign Het
Cdh7 T A 1: 110,048,917 I104N probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col12a1 A G 9: 79,602,185 probably benign Het
Csf2rb A G 15: 78,340,561 E173G probably damaging Het
Cyb561 A G 11: 105,937,719 Y94H probably damaging Het
Cyp3a16 T A 5: 145,467,531 K34M probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah7a T G 1: 53,457,768 M3110L probably benign Het
Dyrk2 T C 10: 118,860,051 E434G probably damaging Het
Ebag9 T G 15: 44,640,420 *214E probably null Het
Egln3 A T 12: 54,203,324 W80R probably damaging Het
Eps15l1 A G 8: 72,382,775 Y336H probably benign Het
Gak A G 5: 108,576,617 S1076P probably benign Het
Glra1 T C 11: 55,527,415 Y168C probably damaging Het
Glrx2 T A 1: 143,745,207 M108K probably damaging Het
Gm3604 A T 13: 62,371,579 S59T possibly damaging Het
Gm8212 A T 14: 44,201,157 probably benign Het
Gmcl1 G T 6: 86,697,525 A457D probably damaging Het
H2-M11 T C 17: 36,547,979 F137S possibly damaging Het
Ighv1-55 C G 12: 115,208,520 W3S probably damaging Het
Il22 T G 10: 118,205,097 V36G possibly damaging Het
Ints1 G A 5: 139,755,198 A1904V probably benign Het
Iqgap2 A G 13: 95,630,053 Y1481H probably damaging Het
Kcnn3 C T 3: 89,609,490 A402V possibly damaging Het
Kif18b A T 11: 102,913,742 I362N possibly damaging Het
Kif5c C G 2: 49,730,190 A223G possibly damaging Het
Kntc1 A G 5: 123,784,182 D948G probably benign Het
Krba1 A G 6: 48,406,356 T229A possibly damaging Het
Leprot T A 4: 101,657,896 I113N probably damaging Het
Lrp1b T C 2: 40,927,973 D2415G probably benign Het
Maats1 A G 16: 38,321,493 I359T probably damaging Het
Mnd1 T A 3: 84,088,174 D171V probably damaging Het
Mthfsd A T 8: 121,098,814 Y339* probably null Het
Nfatc2 G A 2: 168,536,278 T268M probably damaging Het
Olfr1097 G T 2: 86,890,314 P287Q probably damaging Het
Olfr1097 G C 2: 86,890,315 P287A probably damaging Het
Olfr116 T C 17: 37,624,578 D19G probably benign Het
Olfr653 G C 7: 104,580,494 A283P probably damaging Het
Pan3 G A 5: 147,527,128 probably null Het
Pde6a A T 18: 61,253,665 probably null Het
Prss39 T C 1: 34,500,261 I194T possibly damaging Het
Rfx8 T C 1: 39,670,347 S507G probably benign Het
Rif1 T C 2: 52,098,916 S774P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smurf1 C A 5: 144,882,593 E601* probably null Het
Stau2 T C 1: 16,390,021 S231G probably damaging Het
Timp2 T G 11: 118,303,881 M161L probably benign Het
Tlr5 T C 1: 182,973,632 L167P probably damaging Het
Trhr G A 15: 44,197,536 A151T probably benign Het
Unc13d A G 11: 116,066,708 V807A probably damaging Het
Usp2 T C 9: 44,085,208 V7A possibly damaging Het
Uspl1 A G 5: 149,209,779 T447A probably damaging Het
Zan A G 5: 137,436,345 I2232T unknown Het
Zfp12 C A 5: 143,244,795 C292* probably null Het
Zic5 G A 14: 122,459,343 T620M unknown Het
Other mutations in Zfp850
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02278:Zfp850 APN 7 28008397 missense probably damaging 0.96
R0610:Zfp850 UTSW 7 27989394 missense probably damaging 0.99
R0690:Zfp850 UTSW 7 27985217 missense possibly damaging 0.67
R0711:Zfp850 UTSW 7 27990273 missense probably benign 0.00
R1310:Zfp850 UTSW 7 27989459 missense probably benign 0.40
R1594:Zfp850 UTSW 7 27989391 missense probably benign 0.00
R1771:Zfp850 UTSW 7 27985275 nonsense probably null
R2189:Zfp850 UTSW 7 27989055 missense probably benign 0.02
R2192:Zfp850 UTSW 7 27985195 missense probably damaging 1.00
R2417:Zfp850 UTSW 7 27989183 missense possibly damaging 0.54
R4321:Zfp850 UTSW 7 27989400 missense probably damaging 0.99
R4770:Zfp850 UTSW 7 27984986 unclassified probably null
R4970:Zfp850 UTSW 7 27990233 nonsense probably null
R5112:Zfp850 UTSW 7 27990233 nonsense probably null
R5166:Zfp850 UTSW 7 27990356 nonsense probably null
R5303:Zfp850 UTSW 7 28008413 missense probably damaging 1.00
R5315:Zfp850 UTSW 7 27990318 missense probably benign 0.02
R5547:Zfp850 UTSW 7 27989419 missense probably damaging 1.00
R5677:Zfp850 UTSW 7 27989088 missense probably damaging 1.00
R5927:Zfp850 UTSW 7 27990195 missense probably benign 0.17
R6654:Zfp850 UTSW 7 27985215 nonsense probably null
R6950:Zfp850 UTSW 7 27990514 missense possibly damaging 0.86
R6987:Zfp850 UTSW 7 27990001 missense probably damaging 1.00
R6990:Zfp850 UTSW 7 27990376 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAGCTATCGCTTTTGGGTTC -3'
(R):5'- GCCTTGAGCATTTCCTTATGGC -3'

Sequencing Primer
(F):5'- AGTGATGTTGCACTCACAGC -3'
(R):5'- ATGGCTCCCTTCCCACG -3'
Posted On2016-10-05