Incidental Mutation 'R5496:Carmil1'
ID432369
Institutional Source Beutler Lab
Gene Symbol Carmil1
Ensembl Gene ENSMUSG00000021338
Gene Namecapping protein regulator and myosin 1 linker 1
Synonyms1110037D04Rik, Lrrc16, Lrrc16a, Carmil
MMRRC Submission 043057-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R5496 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location24012344-24280795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24155450 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 54 (R54C)
Ref Sequence ENSEMBL: ENSMUSP00000127121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072889] [ENSMUST00000110398] [ENSMUST00000140042]
Predicted Effect probably damaging
Transcript: ENSMUST00000072889
AA Change: R137C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072662
Gene: ENSMUSG00000021338
AA Change: R137C

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
Blast:LRR 451 484 7e-9 BLAST
LRR 574 601 8.81e-2 SMART
Blast:LRR 602 629 6e-10 BLAST
low complexity region 745 758 N/A INTRINSIC
Pfam:CARMIL_C 790 1083 1.1e-101 PFAM
low complexity region 1131 1147 N/A INTRINSIC
low complexity region 1245 1251 N/A INTRINSIC
low complexity region 1253 1268 N/A INTRINSIC
low complexity region 1287 1296 N/A INTRINSIC
low complexity region 1317 1332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110398
AA Change: R137C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106028
Gene: ENSMUSG00000021338
AA Change: R137C

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
LRR 451 480 3.15e1 SMART
Pfam:LRR_6 481 507 1.9e-2 PFAM
LRR 570 597 8.81e-2 SMART
Blast:LRR 598 625 6e-10 BLAST
low complexity region 741 754 N/A INTRINSIC
low complexity region 879 888 N/A INTRINSIC
PDB:3LK3|T 964 1076 1e-56 PDB
low complexity region 1127 1143 N/A INTRINSIC
low complexity region 1241 1247 N/A INTRINSIC
low complexity region 1249 1264 N/A INTRINSIC
low complexity region 1283 1292 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125420
Predicted Effect probably damaging
Transcript: ENSMUST00000140042
AA Change: R54C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127121
Gene: ENSMUSG00000021338
AA Change: R54C

DomainStartEndE-ValueType
PDB:4K17|D 1 58 3e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144159
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,674,818 V84I probably benign Het
Adam10 T G 9: 70,722,739 F151C probably damaging Het
Akap6 A G 12: 53,140,653 S1617G possibly damaging Het
Ano6 T A 15: 95,967,614 probably null Het
Atmin A G 8: 116,957,172 T524A probably benign Het
Bicra C T 7: 15,987,841 V584I probably benign Het
Cbln1 A G 8: 87,471,696 I127T possibly damaging Het
Ccl26 A G 5: 135,563,363 V40A probably benign Het
Cdh7 T A 1: 110,048,917 I104N probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col12a1 A G 9: 79,602,185 probably benign Het
Csf2rb A G 15: 78,340,561 E173G probably damaging Het
Cyb561 A G 11: 105,937,719 Y94H probably damaging Het
Cyp3a16 T A 5: 145,467,531 K34M probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah7a T G 1: 53,457,768 M3110L probably benign Het
Dyrk2 T C 10: 118,860,051 E434G probably damaging Het
Ebag9 T G 15: 44,640,420 *214E probably null Het
Egln3 A T 12: 54,203,324 W80R probably damaging Het
Eps15l1 A G 8: 72,382,775 Y336H probably benign Het
Gak A G 5: 108,576,617 S1076P probably benign Het
Glra1 T C 11: 55,527,415 Y168C probably damaging Het
Glrx2 T A 1: 143,745,207 M108K probably damaging Het
Gm3604 A T 13: 62,371,579 S59T possibly damaging Het
Gm8212 A T 14: 44,201,157 probably benign Het
Gmcl1 G T 6: 86,697,525 A457D probably damaging Het
H2-M11 T C 17: 36,547,979 F137S possibly damaging Het
Ighv1-55 C G 12: 115,208,520 W3S probably damaging Het
Il22 T G 10: 118,205,097 V36G possibly damaging Het
Ints1 G A 5: 139,755,198 A1904V probably benign Het
Iqgap2 A G 13: 95,630,053 Y1481H probably damaging Het
Kcnn3 C T 3: 89,609,490 A402V possibly damaging Het
Kif18b A T 11: 102,913,742 I362N possibly damaging Het
Kif5c C G 2: 49,730,190 A223G possibly damaging Het
Kntc1 A G 5: 123,784,182 D948G probably benign Het
Krba1 A G 6: 48,406,356 T229A possibly damaging Het
Leprot T A 4: 101,657,896 I113N probably damaging Het
Lrp1b T C 2: 40,927,973 D2415G probably benign Het
Maats1 A G 16: 38,321,493 I359T probably damaging Het
Mnd1 T A 3: 84,088,174 D171V probably damaging Het
Mthfsd A T 8: 121,098,814 Y339* probably null Het
Nfatc2 G A 2: 168,536,278 T268M probably damaging Het
Olfr1097 G T 2: 86,890,314 P287Q probably damaging Het
Olfr1097 G C 2: 86,890,315 P287A probably damaging Het
Olfr116 T C 17: 37,624,578 D19G probably benign Het
Olfr653 G C 7: 104,580,494 A283P probably damaging Het
Pan3 G A 5: 147,527,128 probably null Het
Pde6a A T 18: 61,253,665 probably null Het
Prss39 T C 1: 34,500,261 I194T possibly damaging Het
Rfx8 T C 1: 39,670,347 S507G probably benign Het
Rif1 T C 2: 52,098,916 S774P probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smurf1 C A 5: 144,882,593 E601* probably null Het
Stau2 T C 1: 16,390,021 S231G probably damaging Het
Timp2 T G 11: 118,303,881 M161L probably benign Het
Tlr5 T C 1: 182,973,632 L167P probably damaging Het
Trhr G A 15: 44,197,536 A151T probably benign Het
Unc13d A G 11: 116,066,708 V807A probably damaging Het
Usp2 T C 9: 44,085,208 V7A possibly damaging Het
Uspl1 A G 5: 149,209,779 T447A probably damaging Het
Zan A G 5: 137,436,345 I2232T unknown Het
Zfp12 C A 5: 143,244,795 C292* probably null Het
Zfp850 A C 7: 28,007,346 M43R probably damaging Het
Zic5 G A 14: 122,459,343 T620M unknown Het
Other mutations in Carmil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Carmil1 APN 13 24111838 missense possibly damaging 0.68
IGL00392:Carmil1 APN 13 24094491 missense probably damaging 1.00
IGL00943:Carmil1 APN 13 24111886 missense possibly damaging 0.48
IGL01375:Carmil1 APN 13 24094471 missense possibly damaging 0.88
IGL02043:Carmil1 APN 13 24024316 unclassified probably benign
IGL02122:Carmil1 APN 13 24036558 missense possibly damaging 0.95
IGL02178:Carmil1 APN 13 24094403 missense probably damaging 1.00
IGL02264:Carmil1 APN 13 24075716 missense possibly damaging 0.95
IGL02269:Carmil1 APN 13 24155410 nonsense probably null
IGL02546:Carmil1 APN 13 24115499 missense probably damaging 0.98
IGL02740:Carmil1 APN 13 24094518 missense probably damaging 0.98
IGL02876:Carmil1 APN 13 24154668 unclassified probably benign
IGL02976:Carmil1 APN 13 24092551 missense possibly damaging 0.96
IGL03012:Carmil1 APN 13 24036372 missense probably benign 0.19
IGL03107:Carmil1 APN 13 24094455 missense probably damaging 0.99
H8562:Carmil1 UTSW 13 24064647 missense probably benign 0.00
R0085:Carmil1 UTSW 13 24025867 missense probably benign
R0119:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0166:Carmil1 UTSW 13 24099049 missense probably damaging 1.00
R0299:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0304:Carmil1 UTSW 13 24139341 missense probably damaging 0.99
R0335:Carmil1 UTSW 13 24073983 missense probably damaging 1.00
R0369:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0462:Carmil1 UTSW 13 24022511 missense probably benign 0.01
R1203:Carmil1 UTSW 13 24099006 missense probably damaging 1.00
R1540:Carmil1 UTSW 13 24099054 missense possibly damaging 0.92
R1730:Carmil1 UTSW 13 24041689 missense probably damaging 1.00
R1770:Carmil1 UTSW 13 24173674 missense probably damaging 1.00
R1831:Carmil1 UTSW 13 24164879 missense probably benign 0.00
R1893:Carmil1 UTSW 13 24024463 missense possibly damaging 0.72
R2099:Carmil1 UTSW 13 24173667 missense probably benign 0.00
R2153:Carmil1 UTSW 13 24141673 missense probably damaging 0.97
R2296:Carmil1 UTSW 13 24115509 missense probably damaging 1.00
R2869:Carmil1 UTSW 13 24045068 synonymous silent
R2872:Carmil1 UTSW 13 24045068 synonymous silent
R3113:Carmil1 UTSW 13 24069757 missense probably benign 0.22
R3508:Carmil1 UTSW 13 24019676 utr 3 prime probably benign
R3780:Carmil1 UTSW 13 24137169 missense probably damaging 0.99
R3954:Carmil1 UTSW 13 24013407 missense probably benign 0.00
R4027:Carmil1 UTSW 13 24067223 splice site probably benign
R4086:Carmil1 UTSW 13 24024461 missense possibly damaging 0.56
R4647:Carmil1 UTSW 13 24137179 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24067190 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24141676 missense possibly damaging 0.96
R5012:Carmil1 UTSW 13 24024420 missense possibly damaging 0.81
R5166:Carmil1 UTSW 13 24154983 critical splice donor site probably null
R5199:Carmil1 UTSW 13 24111870 missense probably damaging 1.00
R5330:Carmil1 UTSW 13 24025946 splice site probably null
R5472:Carmil1 UTSW 13 24155471 missense probably damaging 0.97
R5478:Carmil1 UTSW 13 24112045 missense probably damaging 1.00
R5775:Carmil1 UTSW 13 24276537 missense probably benign
R5789:Carmil1 UTSW 13 24121848 missense probably damaging 1.00
R5794:Carmil1 UTSW 13 24092550 missense probably damaging 1.00
R5977:Carmil1 UTSW 13 24069736 missense probably damaging 1.00
R6127:Carmil1 UTSW 13 24036352 missense probably benign 0.03
R6128:Carmil1 UTSW 13 24013194 nonsense probably null
R6403:Carmil1 UTSW 13 24081967 missense probably damaging 1.00
R6450:Carmil1 UTSW 13 24036564 missense probably damaging 0.98
R6451:Carmil1 UTSW 13 24092558 nonsense probably null
R6684:Carmil1 UTSW 13 24022542 missense unknown
R6891:Carmil1 UTSW 13 24141723 missense probably benign 0.13
R6902:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R6924:Carmil1 UTSW 13 24075684 nonsense probably null
R6946:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R7038:Carmil1 UTSW 13 24139335 missense probably damaging 1.00
X0025:Carmil1 UTSW 13 24099043 missense possibly damaging 0.47
Z1088:Carmil1 UTSW 13 24044182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGGCTTAAATATAGGACTTCTGTC -3'
(R):5'- GCAAGTCAAAGAATAGTTTTGGCTG -3'

Sequencing Primer
(F):5'- TGTCCACCAATCTAAAGTCTGCATG -3'
(R):5'- GCTGTAGTTGAAGTGACACCCATC -3'
Posted On2016-10-05