Incidental Mutation 'R5497:Galnt5'
ID432393
Institutional Source Beutler Lab
Gene Symbol Galnt5
Ensembl Gene ENSMUSG00000026828
Gene Namepolypeptide N-acetylgalactosaminyltransferase 5
SynonymsppGaNTase-T5
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5497 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location57997884-58045860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58025328 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 632 (M632T)
Ref Sequence ENSEMBL: ENSMUSP00000131362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112616] [ENSMUST00000166729]
Predicted Effect probably damaging
Transcript: ENSMUST00000112616
AA Change: M632T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108235
Gene: ENSMUSG00000026828
AA Change: M632T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 1.3e-33 PFAM
Pfam:Glyco_transf_7C 653 718 1.9e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144671
Predicted Effect probably damaging
Transcript: ENSMUST00000166729
AA Change: M632T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828
AA Change: M632T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 2.1e-30 PFAM
Pfam:Glyco_transf_7C 652 718 7e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound polypeptide N-acetylgalactosaminyltransferase that is found in the Golgi. The encoded protein catalyzes the first step in the mucin-type O-glycosylation of Golgi proteins, transfering an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. [provided by RefSeq, Aug 2016]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Galnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Galnt5 APN 2 57998973 missense probably benign
IGL00515:Galnt5 APN 2 57999068 missense probably benign 0.02
IGL00950:Galnt5 APN 2 57999132 missense probably benign 0.00
IGL00973:Galnt5 APN 2 57998939 missense probably benign 0.02
IGL01152:Galnt5 APN 2 58025393 missense probably benign 0.17
IGL01305:Galnt5 APN 2 58025342 nonsense probably null
IGL01661:Galnt5 APN 2 57999482 missense probably benign 0.03
IGL01719:Galnt5 APN 2 57998543 missense probably damaging 1.00
IGL02165:Galnt5 APN 2 57998865 missense probably benign
IGL02795:Galnt5 APN 2 58027871 missense probably damaging 1.00
IGL02943:Galnt5 APN 2 57999768 missense probably damaging 1.00
IGL03218:Galnt5 APN 2 57999389 missense possibly damaging 0.59
ANU22:Galnt5 UTSW 2 58025342 nonsense probably null
R0082:Galnt5 UTSW 2 57999035 missense possibly damaging 0.92
R0113:Galnt5 UTSW 2 57998877 missense probably benign
R0445:Galnt5 UTSW 2 57998950 missense probably benign
R0517:Galnt5 UTSW 2 58035373 splice site probably benign
R0609:Galnt5 UTSW 2 58024625 missense possibly damaging 0.90
R0639:Galnt5 UTSW 2 57999395 missense probably benign 0.07
R0646:Galnt5 UTSW 2 57999085 missense probably benign 0.00
R0677:Galnt5 UTSW 2 57998980 nonsense probably null
R1808:Galnt5 UTSW 2 58026125 missense probably benign 0.24
R1927:Galnt5 UTSW 2 57998603 missense probably benign 0.00
R1980:Galnt5 UTSW 2 58024723 critical splice donor site probably null
R2517:Galnt5 UTSW 2 57999413 missense probably benign 0.00
R4044:Galnt5 UTSW 2 57998460 missense probably damaging 1.00
R4154:Galnt5 UTSW 2 57998493 missense probably damaging 1.00
R4411:Galnt5 UTSW 2 57999195 missense probably benign 0.01
R4703:Galnt5 UTSW 2 57998907 missense possibly damaging 0.96
R4767:Galnt5 UTSW 2 58028144 missense possibly damaging 0.91
R5118:Galnt5 UTSW 2 58015003 missense probably damaging 1.00
R5506:Galnt5 UTSW 2 57999625 missense probably benign
R5548:Galnt5 UTSW 2 58014910 missense probably damaging 0.99
R5758:Galnt5 UTSW 2 57998430 missense probably benign 0.19
R5937:Galnt5 UTSW 2 58038937 missense probably benign 0.00
R6237:Galnt5 UTSW 2 58035249 missense probably damaging 0.96
R6805:Galnt5 UTSW 2 58035299 missense possibly damaging 0.82
R6959:Galnt5 UTSW 2 57999219 missense probably benign 0.39
R7070:Galnt5 UTSW 2 57998609 missense probably benign 0.00
R7179:Galnt5 UTSW 2 57998609 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTGTCATCAACTGTCCCCAACC -3'
(R):5'- CTCAGGAAACTTTGCTTGCTTTG -3'

Sequencing Primer
(F):5'- ACCTAAACTTGTCACAAAGCTG -3'
(R):5'- CTGACTCCTAGTGATGAGATCATAGG -3'
Posted On2016-10-05