Incidental Mutation 'R5498:Igkv3-9'
ID432468
Institutional Source Beutler Lab
Gene Symbol Igkv3-9
Ensembl Gene ENSMUSG00000095338
Gene Nameimmunoglobulin kappa variable 3-9
Synonyms
MMRRC Submission 043059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R5498 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location70588189-70588777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70588743 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 109 (M109V)
Ref Sequence ENSEMBL: ENSMUSP00000100199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103398]
Predicted Effect probably benign
Transcript: ENSMUST00000103398
AA Change: M109V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100199
Gene: ENSMUSG00000095338
AA Change: M109V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGv 38 114 8.17e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197635
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,328,240 D928G probably damaging Het
4930522L14Rik T A 5: 109,737,547 K148N probably benign Het
Abca6 T A 11: 110,208,844 D959V possibly damaging Het
Acot12 T C 13: 91,781,233 V393A probably damaging Het
Ano3 C A 2: 110,697,103 V587F possibly damaging Het
Bub1 T C 2: 127,814,709 D471G possibly damaging Het
Cdh15 G T 8: 122,865,178 V601F possibly damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Cnot1 A T 8: 95,757,355 I706N possibly damaging Het
Fbn1 A G 2: 125,360,176 I1259T probably damaging Het
Furin A T 7: 80,391,794 W539R probably damaging Het
Hivep1 A T 13: 42,123,158 probably null Het
Klf10 G A 15: 38,296,039 R421W probably damaging Het
Mtor A T 4: 148,540,364 Y2144F possibly damaging Het
Mybpc2 T C 7: 44,516,265 Y297C probably damaging Het
Myom2 G A 8: 15,129,142 E1325K probably benign Het
Nsd1 A T 13: 55,213,302 K28* probably null Het
Olfr458 C T 6: 42,460,294 A242T probably benign Het
Olfr66 T G 7: 103,881,632 T204P probably damaging Het
Phc2 C A 4: 128,708,994 N120K probably benign Het
Pias3 A G 3: 96,702,188 T274A possibly damaging Het
Plcb4 T A 2: 135,976,172 I786N probably damaging Het
Plec G A 15: 76,177,454 S2626L probably damaging Het
Polg A G 7: 79,454,670 L819P probably damaging Het
Ppp2r3d T C 9: 124,439,123 probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnpc3 A G 3: 113,611,207 probably null Het
Sarnp T A 10: 128,853,194 D65E probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc16a10 C T 10: 40,037,327 V462M probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn5 A T 11: 82,957,147 H286L possibly damaging Het
Spag17 G A 3: 100,103,345 A2052T possibly damaging Het
Sptbn5 A T 2: 120,076,638 probably benign Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Trim45 T C 3: 100,925,141 V230A possibly damaging Het
Ube3b T C 5: 114,418,574 F989L probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wdr24 A G 17: 25,824,561 H119R probably damaging Het
Yars2 T A 16: 16,306,523 H331Q possibly damaging Het
Zscan21 T C 5: 138,133,260 S349P probably benign Het
Other mutations in Igkv3-9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Igkv3-9 APN 6 70588461 splice site probably benign
IGL02589:Igkv3-9 APN 6 70588699 missense possibly damaging 0.90
R2509:Igkv3-9 UTSW 6 70588744 missense probably benign 0.03
R4411:Igkv3-9 UTSW 6 70588563 missense probably damaging 0.97
R7302:Igkv3-9 UTSW 6 70588755 missense probably benign 0.01
R7487:Igkv3-9 UTSW 6 70588522 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCGAAAGTGTCAGTTTTGC -3'
(R):5'- GCAGAGTCTTATGGCCTCAAG -3'

Sequencing Primer
(F):5'- GCTGGTACAAGTTTAATGCACTG -3'
(R):5'- CAGAGTCTTATGGCCTCAAGGTTTC -3'
Posted On2016-10-05