Incidental Mutation 'R5485:Spty2d1'
ID432520
Institutional Source Beutler Lab
Gene Symbol Spty2d1
Ensembl Gene ENSMUSG00000049516
Gene NameSPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Synonyms5830435K17Rik
MMRRC Submission 043046-MU
Accession Numbers

Genbank: NM_175318; MGI: 2142062

Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R5485 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46990396-47008411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46997885 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 432 (T432K)
Ref Sequence ENSEMBL: ENSMUSP00000059457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061639]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061639
AA Change: T432K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000059457
Gene: ENSMUSG00000049516
AA Change: T432K

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
coiled coil region 45 82 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 199 215 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
internal_repeat_1 283 336 4.09e-5 PROSPERO
low complexity region 338 353 N/A INTRINSIC
internal_repeat_1 366 420 4.09e-5 PROSPERO
low complexity region 434 468 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
SPT2 573 680 1.3e-32 SMART
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.6%
Validation Efficiency 98% (59/60)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,378 V85D probably benign Het
Abcb8 A G 5: 24,400,161 N115S probably benign Het
Appl1 C A 14: 26,962,866 L75F probably damaging Het
Atp13a5 A G 16: 29,281,942 probably null Het
Atp2c2 T A 8: 119,753,062 probably null Het
Cfap54 T A 10: 93,029,117 I94F probably damaging Het
Clasp1 A G 1: 118,467,913 I194V possibly damaging Het
Crebbp A C 16: 4,114,913 D1000E probably benign Het
Ctdnep1 C T 11: 69,981,490 R3W possibly damaging Het
Dgkb T C 12: 38,127,364 V230A probably damaging Het
Duoxa2 T C 2: 122,299,152 F38L possibly damaging Het
Ecd T C 14: 20,338,205 S172G probably benign Het
Endog G T 2: 30,171,651 probably benign Het
Eqtn G A 4: 94,924,956 P131L possibly damaging Het
Gabbr1 T A 17: 37,056,875 S290T possibly damaging Het
Glt8d2 T A 10: 82,651,448 R319S possibly damaging Het
Gm16686 A G 4: 88,755,404 probably benign Het
Gm5709 A T 3: 59,635,562 noncoding transcript Het
Gm7381 T C 8: 3,842,161 noncoding transcript Het
Gorab T G 1: 163,386,302 D353A possibly damaging Het
Gstm1 A G 3: 108,017,404 L20P probably damaging Het
Hexim2 A G 11: 103,139,058 D312G probably benign Het
Hfm1 A G 5: 106,847,662 probably null Het
Mbd4 C A 6: 115,850,718 A66S probably benign Het
Mmp27 T A 9: 7,573,362 W152R probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mrps18b A T 17: 35,914,344 V102D probably damaging Het
Olfr1513 A T 14: 52,349,319 C242* probably null Het
Peg10 T A 6: 4,755,565 M47K probably benign Het
Plxnc1 T G 10: 94,922,742 Q364P probably benign Het
Psd A T 19: 46,316,089 probably null Het
Rims1 T G 1: 22,483,208 I470L possibly damaging Het
Sbsn T C 7: 30,753,117 V519A possibly damaging Het
Senp1 A G 15: 98,066,496 V279A probably benign Het
Sfxn5 T A 6: 85,332,600 probably benign Het
Slc6a13 T A 6: 121,336,073 M483K probably damaging Het
Slc6a21 G A 7: 45,282,542 probably null Het
Slco6c1 T C 1: 97,125,756 Y140C probably damaging Het
Spata32 A G 11: 103,209,296 S128P probably damaging Het
Stx8 A G 11: 68,020,966 Q170R probably benign Het
Sytl3 G A 17: 6,715,480 V112I probably benign Het
Tdrkh A G 3: 94,428,712 I420V probably benign Het
Tmem117 T C 15: 95,094,830 V457A probably benign Het
Tpk1 T C 6: 43,665,812 probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Tsen54 A G 11: 115,815,222 E90G probably benign Het
Ugt1a2 A T 1: 88,201,246 M204L probably damaging Het
Vmn2r17 A T 5: 109,420,106 I32F probably benign Het
Xkr6 T C 14: 63,819,384 V248A unknown Het
Zfhx4 C A 3: 5,243,007 S431Y probably damaging Het
Zfp318 T A 17: 46,412,254 S1728T possibly damaging Het
Zfp563 T C 17: 33,089,566 probably benign Het
Other mutations in Spty2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Spty2d1 APN 7 46998987 missense probably damaging 1.00
IGL01763:Spty2d1 APN 7 46999848 missense probably damaging 0.99
IGL01988:Spty2d1 APN 7 46997610 missense probably damaging 0.99
IGL02149:Spty2d1 APN 7 47008144 utr 5 prime probably benign
IGL02236:Spty2d1 APN 7 46997612 missense probably benign 0.02
IGL02273:Spty2d1 APN 7 46997573 missense probably damaging 0.97
3-1:Spty2d1 UTSW 7 46998677 missense probably damaging 1.00
R0184:Spty2d1 UTSW 7 46997574 missense possibly damaging 0.94
R0201:Spty2d1 UTSW 7 46997901 nonsense probably null
R1592:Spty2d1 UTSW 7 46998889 missense possibly damaging 0.56
R2116:Spty2d1 UTSW 7 46996185 missense probably damaging 1.00
R2171:Spty2d1 UTSW 7 46994613 missense probably damaging 1.00
R2898:Spty2d1 UTSW 7 46993352 missense unknown
R3857:Spty2d1 UTSW 7 46998296 missense probably benign 0.04
R4080:Spty2d1 UTSW 7 46998581 missense probably damaging 0.99
R4319:Spty2d1 UTSW 7 46998135 missense probably damaging 0.99
R4732:Spty2d1 UTSW 7 46996110 missense probably damaging 1.00
R4733:Spty2d1 UTSW 7 46996110 missense probably damaging 1.00
R5317:Spty2d1 UTSW 7 46998301 missense possibly damaging 0.61
R5711:Spty2d1 UTSW 7 46998097 missense possibly damaging 0.84
R5761:Spty2d1 UTSW 7 46998284 missense probably damaging 1.00
R6418:Spty2d1 UTSW 7 46998003 missense probably damaging 1.00
R7182:Spty2d1 UTSW 7 46998523 missense probably benign 0.09
R7372:Spty2d1 UTSW 7 46998944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGAATGGAACCACTTATG -3'
(R):5'- AGTCCAGGTGTCAGACAACC -3'

Sequencing Primer
(F):5'- TGGATCTCCCAGGGCCAC -3'
(R):5'- GTGTCAGACAACCAGGCAGC -3'
Posted On2016-10-05