Incidental Mutation 'R5452:St3gal4'
ID432581
Institutional Source Beutler Lab
Gene Symbol St3gal4
Ensembl Gene ENSMUSG00000032038
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 4
SynonymsST3Gal IV, Siat4c
MMRRC Submission 042848-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5452 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location35046576-35119268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35053456 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 152 (R152H)
Ref Sequence ENSEMBL: ENSMUSP00000149827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034537] [ENSMUST00000213526] [ENSMUST00000214526] [ENSMUST00000215089] [ENSMUST00000215463] [ENSMUST00000215638] [ENSMUST00000216557] [ENSMUST00000217149] [ENSMUST00000217542]
Predicted Effect probably damaging
Transcript: ENSMUST00000034537
AA Change: R118H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034537
Gene: ENSMUSG00000032038
AA Change: R118H

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_29 70 332 4.1e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213526
AA Change: R139H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214526
AA Change: R152H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000215089
Predicted Effect probably benign
Transcript: ENSMUST00000215463
Predicted Effect probably benign
Transcript: ENSMUST00000215638
Predicted Effect probably damaging
Transcript: ENSMUST00000216557
AA Change: R155H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000217149
Predicted Effect probably benign
Transcript: ENSMUST00000217542
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a null allele show thrombocytopenia, altered platelet physiology, increased bleeding times, and abnormal leukocyte migration. Homozygotes for a different null allele fail to develop seizures in response to kindling, and show anxiety-like behaviors and altered sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,329,113 S1219* probably null Het
Adam20 A T 8: 40,795,764 I304F probably damaging Het
Adamts5 A G 16: 85,869,912 probably null Het
Akr1c6 A G 13: 4,454,545 R132G probably benign Het
Ash1l T A 3: 88,984,876 M1354K possibly damaging Het
C6 T C 15: 4,814,829 I911T possibly damaging Het
Calm2 T C 17: 87,435,722 probably null Het
Ccdc80 G A 16: 45,118,165 R745Q probably damaging Het
Celsr3 T C 9: 108,844,034 I2685T possibly damaging Het
Chkb T C 15: 89,429,585 probably benign Het
Dennd5b T A 6: 149,041,513 probably null Het
Dnah2 T C 11: 69,524,383 Y175C probably damaging Het
Dnajc13 A G 9: 104,192,114 S1154P probably benign Het
Ephb4 T C 5: 137,361,142 S325P probably damaging Het
Fzd9 C T 5: 135,250,860 R57H probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm9949 A G 18: 62,180,516 probably benign Het
Gnb4 A T 3: 32,589,845 M188K probably benign Het
Hr G T 14: 70,556,627 G109V probably damaging Het
Lrp1b A G 2: 40,922,316 S2426P probably damaging Het
Map2k4 A G 11: 65,719,587 W88R probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Moxd2 C T 6: 40,882,114 probably null Het
Mrgprx1 T C 7: 48,021,808 I64V probably benign Het
Olfr493 A C 7: 108,346,105 I292S probably damaging Het
Padi2 T C 4: 140,932,071 F229S probably benign Het
Pappa2 T C 1: 158,838,602 N1136S probably benign Het
Pcdhb1 A T 18: 37,265,758 N254I possibly damaging Het
Plcb2 A G 2: 118,718,246 Y400H probably damaging Het
Plce1 A C 19: 38,620,482 T412P probably benign Het
Prg4 T C 1: 150,455,768 probably benign Het
Prkdc A G 16: 15,768,637 N2510S possibly damaging Het
Psme4 T A 11: 30,791,168 S107T probably benign Het
Rint1 G T 5: 23,794,365 A51S probably benign Het
Rsad1 T A 11: 94,543,689 R306S probably damaging Het
Sema3c T G 5: 17,717,070 probably null Het
Sirt3 G A 7: 140,865,015 T290I probably damaging Het
Skiv2l2 T C 13: 112,913,181 S232G probably null Het
Spam1 G A 6: 24,800,732 G490D probably benign Het
Speer4f2 C T 5: 17,376,500 R147W possibly damaging Het
Sppl2c A T 11: 104,187,300 I309L probably benign Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
Sv2c A T 13: 95,978,083 F532I probably damaging Het
Tacc1 C A 8: 25,164,415 K705N probably null Het
Tekt3 G T 11: 63,094,793 S475I probably damaging Het
Tjap1 T C 17: 46,260,175 T139A probably damaging Het
Tnfrsf8 T A 4: 145,292,644 K207M possibly damaging Het
Tnn T C 1: 160,110,261 T965A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt2a A G 16: 18,250,950 H270R probably damaging Het
Ttc21a T C 9: 119,950,971 L448P probably benign Het
Ttll4 C A 1: 74,679,321 N110K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubr1 A G 2: 120,868,302 Y1595H possibly damaging Het
Unc45a G A 7: 80,329,039 P621S probably damaging Het
Xrn2 A T 2: 147,024,713 probably null Het
Zcchc6 A G 13: 59,800,657 Y215H probably damaging Het
Other mutations in St3gal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:St3gal4 APN 9 35053069 unclassified probably benign
IGL01448:St3gal4 APN 9 35052331 missense probably benign 0.00
IGL01770:St3gal4 APN 9 35052305 missense possibly damaging 0.73
IGL02862:St3gal4 APN 9 35052247 missense probably benign 0.32
fuji UTSW 9 35053173 nonsense probably null
granny_smith UTSW 9 35053262 missense probably damaging 1.00
R0362:St3gal4 UTSW 9 35053173 nonsense probably null
R0863:St3gal4 UTSW 9 35053448 missense probably damaging 1.00
R1457:St3gal4 UTSW 9 35054757 missense possibly damaging 0.66
R1530:St3gal4 UTSW 9 35052296 missense probably benign 0.00
R4991:St3gal4 UTSW 9 35053136 missense possibly damaging 0.93
R6277:St3gal4 UTSW 9 35053262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCCAGGAAAAGAACATC -3'
(R):5'- ACAGGCAAGGAAGCTGTGTC -3'

Sequencing Primer
(F):5'- CAGGAAAAGAACATCCATTACTGG -3'
(R):5'- AGTTACAAGTGTGTGCCACC -3'
Posted On2016-10-06