Incidental Mutation 'R5452:Map4'
ID432584
Institutional Source Beutler Lab
Gene Symbol Map4
Ensembl Gene ENSMUSG00000032479
Gene Namemicrotubule-associated protein 4
SynonymsMtap4, MAP 4
MMRRC Submission 042848-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5452 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109931460-110083955 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 110037783 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000165876]
Predicted Effect probably benign
Transcript: ENSMUST00000035055
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163190
AA Change: T203I
Predicted Effect probably benign
Transcript: ENSMUST00000165876
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201796
AA Change: L165F
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and do not display any overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,329,113 S1219* probably null Het
Adam20 A T 8: 40,795,764 I304F probably damaging Het
Adamts5 A G 16: 85,869,912 probably null Het
Akr1c6 A G 13: 4,454,545 R132G probably benign Het
Ash1l T A 3: 88,984,876 M1354K possibly damaging Het
C6 T C 15: 4,814,829 I911T possibly damaging Het
Calm2 T C 17: 87,435,722 probably null Het
Ccdc80 G A 16: 45,118,165 R745Q probably damaging Het
Celsr3 T C 9: 108,844,034 I2685T possibly damaging Het
Chkb T C 15: 89,429,585 probably benign Het
Dennd5b T A 6: 149,041,513 probably null Het
Dnah2 T C 11: 69,524,383 Y175C probably damaging Het
Dnajc13 A G 9: 104,192,114 S1154P probably benign Het
Ephb4 T C 5: 137,361,142 S325P probably damaging Het
Fzd9 C T 5: 135,250,860 R57H probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm9949 A G 18: 62,180,516 probably benign Het
Gnb4 A T 3: 32,589,845 M188K probably benign Het
Hr G T 14: 70,556,627 G109V probably damaging Het
Lrp1b A G 2: 40,922,316 S2426P probably damaging Het
Map2k4 A G 11: 65,719,587 W88R probably damaging Het
Moxd2 C T 6: 40,882,114 probably null Het
Mrgprx1 T C 7: 48,021,808 I64V probably benign Het
Olfr493 A C 7: 108,346,105 I292S probably damaging Het
Padi2 T C 4: 140,932,071 F229S probably benign Het
Pappa2 T C 1: 158,838,602 N1136S probably benign Het
Pcdhb1 A T 18: 37,265,758 N254I possibly damaging Het
Plcb2 A G 2: 118,718,246 Y400H probably damaging Het
Plce1 A C 19: 38,620,482 T412P probably benign Het
Prg4 T C 1: 150,455,768 probably benign Het
Prkdc A G 16: 15,768,637 N2510S possibly damaging Het
Psme4 T A 11: 30,791,168 S107T probably benign Het
Rint1 G T 5: 23,794,365 A51S probably benign Het
Rsad1 T A 11: 94,543,689 R306S probably damaging Het
Sema3c T G 5: 17,717,070 probably null Het
Sirt3 G A 7: 140,865,015 T290I probably damaging Het
Skiv2l2 T C 13: 112,913,181 S232G probably null Het
Spam1 G A 6: 24,800,732 G490D probably benign Het
Speer4f2 C T 5: 17,376,500 R147W possibly damaging Het
Sppl2c A T 11: 104,187,300 I309L probably benign Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
St3gal4 C T 9: 35,053,456 R152H probably damaging Het
Sv2c A T 13: 95,978,083 F532I probably damaging Het
Tacc1 C A 8: 25,164,415 K705N probably null Het
Tekt3 G T 11: 63,094,793 S475I probably damaging Het
Tjap1 T C 17: 46,260,175 T139A probably damaging Het
Tnfrsf8 T A 4: 145,292,644 K207M possibly damaging Het
Tnn T C 1: 160,110,261 T965A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt2a A G 16: 18,250,950 H270R probably damaging Het
Ttc21a T C 9: 119,950,971 L448P probably benign Het
Ttll4 C A 1: 74,679,321 N110K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubr1 A G 2: 120,868,302 Y1595H possibly damaging Het
Unc45a G A 7: 80,329,039 P621S probably damaging Het
Xrn2 A T 2: 147,024,713 probably null Het
Zcchc6 A G 13: 59,800,657 Y215H probably damaging Het
Other mutations in Map4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Map4 APN 9 110072604 splice site probably benign
IGL01331:Map4 APN 9 110034801 missense probably benign 0.04
IGL01599:Map4 APN 9 110034768 missense probably benign 0.26
IGL01631:Map4 APN 9 110063133 unclassified probably benign
IGL02208:Map4 APN 9 109978870 start codon destroyed probably null 1.00
IGL02455:Map4 APN 9 109999833 missense probably benign 0.15
IGL02625:Map4 APN 9 110064417 missense probably damaging 1.00
PIT4486001:Map4 UTSW 9 110072614 missense probably damaging 1.00
R0149:Map4 UTSW 9 110067624 missense probably damaging 0.96
R0384:Map4 UTSW 9 110034628 missense probably damaging 0.99
R0392:Map4 UTSW 9 110078045 missense probably damaging 1.00
R0496:Map4 UTSW 9 110039850 intron probably benign
R0526:Map4 UTSW 9 110037278 splice site probably null
R0555:Map4 UTSW 9 109979103 splice site probably benign
R0571:Map4 UTSW 9 110036766 missense probably benign 0.00
R0698:Map4 UTSW 9 110068788 nonsense probably null
R0762:Map4 UTSW 9 110038478 intron probably benign
R0862:Map4 UTSW 9 109978969 missense probably damaging 1.00
R0864:Map4 UTSW 9 109978969 missense probably damaging 1.00
R1168:Map4 UTSW 9 110034964 missense probably benign 0.00
R1238:Map4 UTSW 9 110068580 missense probably benign 0.00
R1735:Map4 UTSW 9 110034955 missense probably benign 0.00
R1869:Map4 UTSW 9 110034964 missense probably benign 0.00
R1869:Map4 UTSW 9 110068928 missense possibly damaging 0.95
R2196:Map4 UTSW 9 110071048 missense probably damaging 1.00
R2264:Map4 UTSW 9 110081457 missense probably damaging 1.00
R2507:Map4 UTSW 9 110037483 intron probably benign
R2512:Map4 UTSW 9 110034702 missense possibly damaging 0.48
R3087:Map4 UTSW 9 110053189 missense possibly damaging 0.84
R3154:Map4 UTSW 9 109999792 missense probably benign 0.19
R3498:Map4 UTSW 9 110035212 missense probably benign 0.03
R3547:Map4 UTSW 9 110052198 missense possibly damaging 0.61
R3751:Map4 UTSW 9 110038674 intron probably benign
R4036:Map4 UTSW 9 110032215 missense possibly damaging 0.47
R4423:Map4 UTSW 9 110067594 missense probably damaging 1.00
R4505:Map4 UTSW 9 110032185 missense probably benign 0.01
R4561:Map4 UTSW 9 110052371 missense possibly damaging 0.91
R4577:Map4 UTSW 9 110081421 missense possibly damaging 0.48
R4601:Map4 UTSW 9 110052819 missense possibly damaging 0.75
R4795:Map4 UTSW 9 110035263 missense probably benign 0.00
R4801:Map4 UTSW 9 110035257 missense probably benign 0.15
R4802:Map4 UTSW 9 110035257 missense probably benign 0.15
R4999:Map4 UTSW 9 110038377 intron probably benign
R5020:Map4 UTSW 9 110068800 missense probably benign 0.02
R5021:Map4 UTSW 9 110038089 nonsense probably null
R5049:Map4 UTSW 9 110079814 nonsense probably null
R5451:Map4 UTSW 9 110037783 intron probably benign
R5453:Map4 UTSW 9 110037783 intron probably benign
R5492:Map4 UTSW 9 110052382 missense possibly damaging 0.68
R5532:Map4 UTSW 9 110034678 missense probably benign 0.24
R5602:Map4 UTSW 9 110052700 missense possibly damaging 0.84
R5628:Map4 UTSW 9 110081847 missense probably benign 0.04
R5896:Map4 UTSW 9 110072634 missense possibly damaging 0.91
R6017:Map4 UTSW 9 110034619 missense probably benign 0.00
R6084:Map4 UTSW 9 110064292 missense probably damaging 1.00
R6294:Map4 UTSW 9 110002746 missense possibly damaging 0.82
R6397:Map4 UTSW 9 110027716 missense possibly damaging 0.78
R6773:Map4 UTSW 9 110034925 missense probably benign 0.00
R6997:Map4 UTSW 9 110052914 missense probably benign 0.35
R7141:Map4 UTSW 9 109978870 start codon destroyed probably null 1.00
R7187:Map4 UTSW 9 110053133 missense probably benign 0.03
R7320:Map4 UTSW 9 110081517 missense probably benign 0.24
R7479:Map4 UTSW 9 110068824 missense possibly damaging 0.94
R7487:Map4 UTSW 9 110027715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATATCCTCAGTCCCGAGC -3'
(R):5'- AGCTGTCACTTTGTGTGCAG -3'

Sequencing Primer
(F):5'- TGGGATGACGATAATGCAG -3'
(R):5'- GGGTTCCTTTCAAACTCGATGGAC -3'
Posted On2016-10-06