Incidental Mutation 'R5452:Tekt3'
ID432587
Institutional Source Beutler Lab
Gene Symbol Tekt3
Ensembl Gene ENSMUSG00000042189
Gene Nametektin 3
Synonyms4933407G07Rik
MMRRC Submission 042848-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5452 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location63061654-63094964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63094793 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 475 (S475I)
Ref Sequence ENSEMBL: ENSMUSP00000042063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035732]
Predicted Effect probably damaging
Transcript: ENSMUST00000035732
AA Change: S475I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042063
Gene: ENSMUSG00000042189
AA Change: S475I

DomainStartEndE-ValueType
Pfam:Tektin 99 481 5.6e-149 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit defective sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,329,113 S1219* probably null Het
Adam20 A T 8: 40,795,764 I304F probably damaging Het
Adamts5 A G 16: 85,869,912 probably null Het
Akr1c6 A G 13: 4,454,545 R132G probably benign Het
Ash1l T A 3: 88,984,876 M1354K possibly damaging Het
C6 T C 15: 4,814,829 I911T possibly damaging Het
Calm2 T C 17: 87,435,722 probably null Het
Ccdc80 G A 16: 45,118,165 R745Q probably damaging Het
Celsr3 T C 9: 108,844,034 I2685T possibly damaging Het
Chkb T C 15: 89,429,585 probably benign Het
Dennd5b T A 6: 149,041,513 probably null Het
Dnah2 T C 11: 69,524,383 Y175C probably damaging Het
Dnajc13 A G 9: 104,192,114 S1154P probably benign Het
Ephb4 T C 5: 137,361,142 S325P probably damaging Het
Fzd9 C T 5: 135,250,860 R57H probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm9949 A G 18: 62,180,516 probably benign Het
Gnb4 A T 3: 32,589,845 M188K probably benign Het
Hr G T 14: 70,556,627 G109V probably damaging Het
Lrp1b A G 2: 40,922,316 S2426P probably damaging Het
Map2k4 A G 11: 65,719,587 W88R probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Moxd2 C T 6: 40,882,114 probably null Het
Mrgprx1 T C 7: 48,021,808 I64V probably benign Het
Olfr493 A C 7: 108,346,105 I292S probably damaging Het
Padi2 T C 4: 140,932,071 F229S probably benign Het
Pappa2 T C 1: 158,838,602 N1136S probably benign Het
Pcdhb1 A T 18: 37,265,758 N254I possibly damaging Het
Plcb2 A G 2: 118,718,246 Y400H probably damaging Het
Plce1 A C 19: 38,620,482 T412P probably benign Het
Prg4 T C 1: 150,455,768 probably benign Het
Prkdc A G 16: 15,768,637 N2510S possibly damaging Het
Psme4 T A 11: 30,791,168 S107T probably benign Het
Rint1 G T 5: 23,794,365 A51S probably benign Het
Rsad1 T A 11: 94,543,689 R306S probably damaging Het
Sema3c T G 5: 17,717,070 probably null Het
Sirt3 G A 7: 140,865,015 T290I probably damaging Het
Skiv2l2 T C 13: 112,913,181 S232G probably null Het
Spam1 G A 6: 24,800,732 G490D probably benign Het
Speer4f2 C T 5: 17,376,500 R147W possibly damaging Het
Sppl2c A T 11: 104,187,300 I309L probably benign Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
St3gal4 C T 9: 35,053,456 R152H probably damaging Het
Sv2c A T 13: 95,978,083 F532I probably damaging Het
Tacc1 C A 8: 25,164,415 K705N probably null Het
Tjap1 T C 17: 46,260,175 T139A probably damaging Het
Tnfrsf8 T A 4: 145,292,644 K207M possibly damaging Het
Tnn T C 1: 160,110,261 T965A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt2a A G 16: 18,250,950 H270R probably damaging Het
Ttc21a T C 9: 119,950,971 L448P probably benign Het
Ttll4 C A 1: 74,679,321 N110K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubr1 A G 2: 120,868,302 Y1595H possibly damaging Het
Unc45a G A 7: 80,329,039 P621S probably damaging Het
Xrn2 A T 2: 147,024,713 probably null Het
Zcchc6 A G 13: 59,800,657 Y215H probably damaging Het
Other mutations in Tekt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Tekt3 APN 11 63070238 missense probably benign 0.19
IGL00851:Tekt3 APN 11 63070400 missense probably benign 0.01
IGL01469:Tekt3 APN 11 63073468 missense probably damaging 1.00
IGL02123:Tekt3 APN 11 63083940 missense probably benign 0.05
R1517:Tekt3 UTSW 11 63070490 missense probably damaging 1.00
R1616:Tekt3 UTSW 11 63087198 splice site probably null
R1750:Tekt3 UTSW 11 63070041 missense probably damaging 0.96
R2087:Tekt3 UTSW 11 63094697 missense possibly damaging 0.95
R2174:Tekt3 UTSW 11 63094688 missense possibly damaging 0.90
R2249:Tekt3 UTSW 11 63083952 missense probably benign
R4835:Tekt3 UTSW 11 63081259 missense probably benign 0.19
R5198:Tekt3 UTSW 11 63070308 missense probably damaging 1.00
R5518:Tekt3 UTSW 11 63083942 missense probably benign 0.00
R5946:Tekt3 UTSW 11 63094747 missense probably damaging 0.98
R6150:Tekt3 UTSW 11 63094657 missense possibly damaging 0.95
R6191:Tekt3 UTSW 11 63078173 missense probably damaging 0.98
R6547:Tekt3 UTSW 11 63070478 missense possibly damaging 0.50
R6597:Tekt3 UTSW 11 63081259 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GTCCACCTAACCATGTGCTC -3'
(R):5'- TTAGGCACAAATGAGAGGCCATC -3'

Sequencing Primer
(F):5'- ATGTGCTCCCTCCTGCAG -3'
(R):5'- CCAGAACAAGGTCATGGTGTTTC -3'
Posted On2016-10-06