Incidental Mutation 'R5453:Olfr427'
ID432612
Institutional Source Beutler Lab
Gene Symbol Olfr427
Ensembl Gene ENSMUSG00000059371
Gene Nameolfactory receptor 427
SynonymsMOR105-7, MOR105-9, GA_x6K02T2P20D-21075927-21074980
MMRRC Submission 043017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location174096891-174103224 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174099467 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 3 (K3R)
Ref Sequence ENSEMBL: ENSMUSP00000149570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080831] [ENSMUST00000213832]
Predicted Effect probably benign
Transcript: ENSMUST00000080831
AA Change: K3R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079644
Gene: ENSMUSG00000059371
AA Change: K3R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.2e-58 PFAM
Pfam:7tm_1 41 289 3.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201135
Predicted Effect probably benign
Transcript: ENSMUST00000213832
AA Change: K3R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,595,796 probably null Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Anxa1 C T 19: 20,380,339 probably null Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cd163 C T 6: 124,312,541 A406V probably damaging Het
Cdh13 A T 8: 119,198,967 D358V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Emsy T C 7: 98,600,806 K758R probably damaging Het
Fam126a A G 5: 23,987,879 probably null Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hoxb3 T C 11: 96,344,654 S136P probably damaging Het
Hras A C 7: 141,192,855 V29G probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Rbm47 A G 5: 66,027,182 V26A probably benign Het
Ripk2 A T 4: 16,151,989 I190N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp108 G T 7: 24,261,264 G427W probably damaging Het
Zfp84 A G 7: 29,776,297 E138G possibly damaging Het
Other mutations in Olfr427
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Olfr427 APN 1 174100367 missense probably benign
IGL01804:Olfr427 APN 1 174099835 missense probably damaging 1.00
IGL02573:Olfr427 APN 1 174100130 missense possibly damaging 0.94
IGL02736:Olfr427 APN 1 174099647 missense probably damaging 0.99
R0012:Olfr427 UTSW 1 174100207 missense probably damaging 1.00
R0437:Olfr427 UTSW 1 174100399 missense probably benign 0.04
R0688:Olfr427 UTSW 1 174100064 missense probably damaging 1.00
R1473:Olfr427 UTSW 1 174099749 missense probably damaging 1.00
R1754:Olfr427 UTSW 1 174100033 missense probably benign 0.24
R5776:Olfr427 UTSW 1 174099773 missense probably damaging 1.00
R6700:Olfr427 UTSW 1 174099839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTCCTAGTAAACATCATGTTCTC -3'
(R):5'- ACATGGGATTGTGCAGACGG -3'

Sequencing Primer
(F):5'- TGGAAGTTGCGAAATTGTCATTC -3'
(R):5'- ATTGTGCAGACGGACATCC -3'
Posted On2016-10-06