Incidental Mutation 'R5453:Ripk2'
ID432616
Institutional Source Beutler Lab
Gene Symbol Ripk2
Ensembl Gene ENSMUSG00000041135
Gene Namereceptor (TNFRSF)-interacting serine-threonine kinase 2
SynonymsCCK, RICK, CARD3, D4Bwg0615e, 2210420D18Rik, RIP2, CARDIAK
MMRRC Submission 043017-MU
Accession Numbers

Ncbi RefSeq: NM_138952.3; MGI:1891456

Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location16122733-16163647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16151989 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 190 (I190N)
Ref Sequence ENSEMBL: ENSMUSP00000038833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037035] [ENSMUST00000183871]
Predicted Effect probably damaging
Transcript: ENSMUST00000037035
AA Change: I190N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038833
Gene: ENSMUSG00000041135
AA Change: I190N

DomainStartEndE-ValueType
Pfam:Pkinase 18 289 2.1e-43 PFAM
Pfam:Pkinase_Tyr 18 290 1.1e-45 PFAM
CARD 434 522 2.34e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183871
AA Change: I190N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139381
Gene: ENSMUSG00000041135
AA Change: I190N

DomainStartEndE-ValueType
Pfam:Pkinase 18 290 5.6e-46 PFAM
Pfam:Pkinase_Tyr 18 290 1.2e-44 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype Strain: 3622328; 2660793;2446070
FUNCTION: This gene encodes a member of the receptor-interacting protein family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain, and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of nuclear factor kappa B and inducer of apoptosis in response to various stimuli. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to impaired cytokine production in response to LPS treatment, and may result in resistance to LPS-induced septic shock and defects in Toll-like receptor and T-cell receptor signaling. Macrophages homozygous for a knock-in allele show normal LPS signaling. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,595,796 probably null Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Anxa1 C T 19: 20,380,339 probably null Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cd163 C T 6: 124,312,541 A406V probably damaging Het
Cdh13 A T 8: 119,198,967 D358V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Emsy T C 7: 98,600,806 K758R probably damaging Het
Fam126a A G 5: 23,987,879 probably null Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hoxb3 T C 11: 96,344,654 S136P probably damaging Het
Hras A C 7: 141,192,855 V29G probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Olfr427 A G 1: 174,099,467 K3R probably benign Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Rbm47 A G 5: 66,027,182 V26A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp108 G T 7: 24,261,264 G427W probably damaging Het
Zfp84 A G 7: 29,776,297 E138G possibly damaging Het
Other mutations in Ripk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Ripk2 APN 4 16139198 splice site probably benign
IGL01346:Ripk2 APN 4 16132775 critical splice donor site probably null
IGL01631:Ripk2 APN 4 16163342 missense possibly damaging 0.83
IGL02151:Ripk2 APN 4 16139240 missense possibly damaging 0.83
IGL03093:Ripk2 APN 4 16152056 missense probably damaging 1.00
R0066:Ripk2 UTSW 4 16123868 nonsense probably null
R0066:Ripk2 UTSW 4 16123868 nonsense probably null
R0189:Ripk2 UTSW 4 16129125 intron probably null
R1454:Ripk2 UTSW 4 16163239 missense probably damaging 0.96
R1715:Ripk2 UTSW 4 16155192 critical splice acceptor site probably null
R2153:Ripk2 UTSW 4 16132775 critical splice donor site probably null
R2266:Ripk2 UTSW 4 16152011 missense possibly damaging 0.91
R2394:Ripk2 UTSW 4 16132774 splice site probably benign
R3693:Ripk2 UTSW 4 16127695 missense probably benign
R4412:Ripk2 UTSW 4 16124511 missense probably benign
R4463:Ripk2 UTSW 4 16151968 missense possibly damaging 0.70
R4843:Ripk2 UTSW 4 16155073 missense probably damaging 0.99
R5085:Ripk2 UTSW 4 16127663 missense possibly damaging 0.78
R6197:Ripk2 UTSW 4 16163330 missense probably damaging 1.00
R6576:Ripk2 UTSW 4 16131558 intron probably null
R6967:Ripk2 UTSW 4 16158275 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCCTTGTTACATGTTCCTAG -3'
(R):5'- CATGTGCAGTTATTGGTACTAGC -3'

Sequencing Primer
(F):5'- CCTTGTTACATGTTCCTAGGACAAAC -3'
(R):5'- CAACGCCACTTACAGATTG -3'
Posted On2016-10-06