Incidental Mutation 'R5453:Rbm47'
ID432621
Institutional Source Beutler Lab
Gene Symbol Rbm47
Ensembl Gene ENSMUSG00000070780
Gene NameRNA binding motif protein 47
Synonyms
MMRRC Submission 043017-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location66016549-66173118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66027182 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 26 (V26A)
Ref Sequence ENSEMBL: ENSMUSP00000144122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094756] [ENSMUST00000094757] [ENSMUST00000113724] [ENSMUST00000113726] [ENSMUST00000167950] [ENSMUST00000200775] [ENSMUST00000200852] [ENSMUST00000201544] [ENSMUST00000201561] [ENSMUST00000202700]
Predicted Effect probably benign
Transcript: ENSMUST00000094756
AA Change: V26A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000092348
Gene: ENSMUSG00000070780
AA Change: V26A

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094757
AA Change: V26A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000092349
Gene: ENSMUSG00000070780
AA Change: V26A

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113724
AA Change: V26A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109353
Gene: ENSMUSG00000070780
AA Change: V26A

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113726
AA Change: V26A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109355
Gene: ENSMUSG00000070780
AA Change: V26A

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132606
AA Change: W253R
Predicted Effect probably benign
Transcript: ENSMUST00000145625
AA Change: V26A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123167
Gene: ENSMUSG00000070780
AA Change: V26A

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167950
AA Change: V26A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128016
Gene: ENSMUSG00000070780
AA Change: V26A

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200775
AA Change: V26A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144325
Gene: ENSMUSG00000070780
AA Change: V26A

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200852
AA Change: V26A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144505
Gene: ENSMUSG00000070780
AA Change: V26A

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201311
Predicted Effect probably benign
Transcript: ENSMUST00000201544
AA Change: V26A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144122
Gene: ENSMUSG00000070780
AA Change: V26A

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
RRM 72 145 7.19e-16 SMART
RRM 152 229 3.74e-5 SMART
RRM 247 314 1.21e-13 SMART
low complexity region 330 342 N/A INTRINSIC
low complexity region 381 397 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 545 554 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201561
Predicted Effect probably benign
Transcript: ENSMUST00000202700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202794
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit partial prenatal lethality. Surviving adults are small and display impaired cytidine to uridine RNA editing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,595,796 probably null Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Anxa1 C T 19: 20,380,339 probably null Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cd163 C T 6: 124,312,541 A406V probably damaging Het
Cdh13 A T 8: 119,198,967 D358V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Emsy T C 7: 98,600,806 K758R probably damaging Het
Fam126a A G 5: 23,987,879 probably null Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hoxb3 T C 11: 96,344,654 S136P probably damaging Het
Hras A C 7: 141,192,855 V29G probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Olfr427 A G 1: 174,099,467 K3R probably benign Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Ripk2 A T 4: 16,151,989 I190N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp108 G T 7: 24,261,264 G427W probably damaging Het
Zfp84 A G 7: 29,776,297 E138G possibly damaging Het
Other mutations in Rbm47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Rbm47 APN 5 66026738 missense possibly damaging 0.75
IGL01648:Rbm47 APN 5 66024978 missense possibly damaging 0.59
IGL02323:Rbm47 APN 5 66026429 missense probably damaging 1.00
IGL02456:Rbm47 APN 5 66027021 missense probably damaging 1.00
IGL03329:Rbm47 APN 5 66026693 missense probably damaging 0.98
R0131:Rbm47 UTSW 5 66026529 missense possibly damaging 0.86
R1575:Rbm47 UTSW 5 66025015 missense probably benign 0.00
R1587:Rbm47 UTSW 5 66024991 missense probably benign 0.23
R1645:Rbm47 UTSW 5 66027138 missense probably benign 0.44
R1750:Rbm47 UTSW 5 66019310 missense possibly damaging 0.78
R4085:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4087:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4090:Rbm47 UTSW 5 66022737 missense probably benign 0.05
R4280:Rbm47 UTSW 5 66026177 missense probably damaging 1.00
R4714:Rbm47 UTSW 5 66025052 missense probably damaging 1.00
R4744:Rbm47 UTSW 5 66026693 missense probably damaging 0.98
R4807:Rbm47 UTSW 5 66019304 missense possibly damaging 0.71
R6090:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6091:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6136:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6137:Rbm47 UTSW 5 66026283 missense probably damaging 1.00
R6159:Rbm47 UTSW 5 66026816 missense probably damaging 0.99
R6181:Rbm47 UTSW 5 66026490 missense possibly damaging 0.92
R6425:Rbm47 UTSW 5 66022816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACCAGCTCATCTTCATAC -3'
(R):5'- TTGACGGTAGTGCATCACCAG -3'

Sequencing Primer
(F):5'- AGCTCATCTTCATACACGTCACG -3'
(R):5'- TGCATCACCAGAGAGTGAGC -3'
Posted On2016-10-06