Incidental Mutation 'R5453:Cd163'
ID432624
Institutional Source Beutler Lab
Gene Symbol Cd163
Ensembl Gene ENSMUSG00000008845
Gene NameCD163 antigen
Synonyms
MMRRC Submission 043017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124304656-124330527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124312541 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 406 (A406V)
Ref Sequence ENSEMBL: ENSMUSP00000108160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]
Predicted Effect probably damaging
Transcript: ENSMUST00000032234
AA Change: A406V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: A406V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SR 50 150 1.1e-52 SMART
SR 157 258 1.4e-55 SMART
SR 265 365 7.3e-60 SMART
SR 372 472 1.2e-35 SMART
SR 477 577 2.3e-41 SMART
SR 582 682 9.8e-39 SMART
SR 719 819 1.1e-60 SMART
SR 824 927 4e-24 SMART
SR 930 1030 2.3e-55 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112541
AA Change: A406V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: A406V

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
SR 50 150 2.26e-50 SMART
SR 157 258 3.11e-53 SMART
SR 265 365 1.54e-57 SMART
SR 372 472 2.64e-33 SMART
SR 477 577 5.03e-39 SMART
SR 582 682 2.09e-36 SMART
SR 719 819 2.38e-58 SMART
SR 824 927 8.93e-22 SMART
SR 930 1030 5.06e-53 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,595,796 probably null Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Anxa1 C T 19: 20,380,339 probably null Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cdh13 A T 8: 119,198,967 D358V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Emsy T C 7: 98,600,806 K758R probably damaging Het
Fam126a A G 5: 23,987,879 probably null Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hoxb3 T C 11: 96,344,654 S136P probably damaging Het
Hras A C 7: 141,192,855 V29G probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Olfr427 A G 1: 174,099,467 K3R probably benign Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Rbm47 A G 5: 66,027,182 V26A probably benign Het
Ripk2 A T 4: 16,151,989 I190N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp108 G T 7: 24,261,264 G427W probably damaging Het
Zfp84 A G 7: 29,776,297 E138G possibly damaging Het
Other mutations in Cd163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Cd163 APN 6 124329101 splice site probably benign
IGL00755:Cd163 APN 6 124318657 missense possibly damaging 0.70
IGL01690:Cd163 APN 6 124307318 missense possibly damaging 0.89
IGL02101:Cd163 APN 6 124307287 nonsense probably null
IGL02733:Cd163 APN 6 124325341 missense probably damaging 1.00
IGL02801:Cd163 APN 6 124320529 missense probably benign 0.00
IGL02897:Cd163 APN 6 124325527 missense probably damaging 1.00
IGL03074:Cd163 APN 6 124317986 missense probably benign 0.00
IGL03283:Cd163 APN 6 124309199 missense possibly damaging 0.49
hottish UTSW 6 124309208 missense probably damaging 1.00
R0494:Cd163 UTSW 6 124311449 missense probably damaging 1.00
R0554:Cd163 UTSW 6 124312660 missense probably benign 0.03
R0622:Cd163 UTSW 6 124317352 missense probably damaging 1.00
R1004:Cd163 UTSW 6 124325347 missense probably damaging 1.00
R1061:Cd163 UTSW 6 124309169 missense probably benign 0.00
R1132:Cd163 UTSW 6 124309096 nonsense probably null
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1436:Cd163 UTSW 6 124327931 missense possibly damaging 0.47
R1463:Cd163 UTSW 6 124311447 missense probably damaging 1.00
R1532:Cd163 UTSW 6 124312730 missense possibly damaging 0.91
R1541:Cd163 UTSW 6 124327961 missense probably benign
R1654:Cd163 UTSW 6 124317581 missense probably damaging 1.00
R1717:Cd163 UTSW 6 124329588 utr 3 prime probably benign
R1744:Cd163 UTSW 6 124307028 missense possibly damaging 0.94
R2014:Cd163 UTSW 6 124325498 missense probably damaging 0.99
R2035:Cd163 UTSW 6 124320629 missense probably damaging 0.97
R2095:Cd163 UTSW 6 124317822 missense probably damaging 1.00
R2124:Cd163 UTSW 6 124318856 missense probably damaging 1.00
R2146:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R2353:Cd163 UTSW 6 124319156 nonsense probably null
R3854:Cd163 UTSW 6 124311566 missense probably damaging 1.00
R4425:Cd163 UTSW 6 124327903 missense possibly damaging 0.94
R4631:Cd163 UTSW 6 124329086 makesense probably null
R4647:Cd163 UTSW 6 124320621 missense probably damaging 1.00
R4713:Cd163 UTSW 6 124317618 critical splice donor site probably null
R4803:Cd163 UTSW 6 124312430 missense probably damaging 0.99
R4996:Cd163 UTSW 6 124319147 missense probably benign 0.00
R5022:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5023:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5032:Cd163 UTSW 6 124311669 missense probably damaging 1.00
R5057:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5121:Cd163 UTSW 6 124317989 missense probably damaging 1.00
R5436:Cd163 UTSW 6 124327964 missense probably benign
R5723:Cd163 UTSW 6 124319063 missense probably benign 0.00
R5929:Cd163 UTSW 6 124326609 critical splice donor site probably null
R5943:Cd163 UTSW 6 124329602 makesense probably null
R5964:Cd163 UTSW 6 124326572 missense probably benign 0.01
R5966:Cd163 UTSW 6 124320636 nonsense probably null
R6279:Cd163 UTSW 6 124317991 nonsense probably null
R6300:Cd163 UTSW 6 124317991 nonsense probably null
R6499:Cd163 UTSW 6 124304744 missense probably benign 0.00
R6602:Cd163 UTSW 6 124311635 missense probably damaging 1.00
R6708:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R6767:Cd163 UTSW 6 124304779 missense possibly damaging 0.56
R6979:Cd163 UTSW 6 124317986 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACAGGTTCCAGTGTCTCAG -3'
(R):5'- TCTTCGAAATTATCACAGGAAAGGC -3'

Sequencing Primer
(F):5'- CCAGTGTCTCAGTGTCTGCAAAG -3'
(R):5'- TTATCACAGGAAAGGCCGCCC -3'
Posted On2016-10-06