Incidental Mutation 'R5453:Zfp84'
ID432627
Institutional Source Beutler Lab
Gene Symbol Zfp84
Ensembl Gene ENSMUSG00000046185
Gene Namezinc finger protein 84
SynonymsC86188, 4633401C23Rik, Zfp69, KRAB18, 2210410P13Rik
MMRRC Submission 043017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29768552-29779821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29776297 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 138 (E138G)
Ref Sequence ENSEMBL: ENSMUSP00000032802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032802]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032802
AA Change: E138G

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032802
Gene: ENSMUSG00000046185
AA Change: E138G

DomainStartEndE-ValueType
KRAB 14 74 9.09e-36 SMART
ZnF_C2H2 249 271 1.67e-2 SMART
ZnF_C2H2 277 299 1.43e-1 SMART
ZnF_C2H2 305 327 5.81e-2 SMART
ZnF_C2H2 333 355 1.95e-3 SMART
ZnF_C2H2 361 383 8.6e-5 SMART
ZnF_C2H2 389 411 2.32e-1 SMART
ZnF_C2H2 417 439 3.89e-3 SMART
ZnF_C2H2 445 467 1.69e-3 SMART
ZnF_C2H2 473 495 9.58e-3 SMART
ZnF_C2H2 501 523 1.38e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158514
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,595,796 probably null Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Anxa1 C T 19: 20,380,339 probably null Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cd163 C T 6: 124,312,541 A406V probably damaging Het
Cdh13 A T 8: 119,198,967 D358V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Emsy T C 7: 98,600,806 K758R probably damaging Het
Fam126a A G 5: 23,987,879 probably null Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hoxb3 T C 11: 96,344,654 S136P probably damaging Het
Hras A C 7: 141,192,855 V29G probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Olfr427 A G 1: 174,099,467 K3R probably benign Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Rbm47 A G 5: 66,027,182 V26A probably benign Het
Ripk2 A T 4: 16,151,989 I190N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp108 G T 7: 24,261,264 G427W probably damaging Het
Other mutations in Zfp84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Zfp84 APN 7 29776666 missense probably benign 0.16
IGL03022:Zfp84 APN 7 29775334 splice site probably benign
R0666:Zfp84 UTSW 7 29776851 missense probably damaging 1.00
R0781:Zfp84 UTSW 7 29771372 start codon destroyed probably null 0.02
R1110:Zfp84 UTSW 7 29771372 start codon destroyed probably null 0.02
R1353:Zfp84 UTSW 7 29776175 missense probably benign 0.02
R1495:Zfp84 UTSW 7 29777303 nonsense probably null
R1496:Zfp84 UTSW 7 29776614 missense possibly damaging 0.53
R1681:Zfp84 UTSW 7 29777400 missense probably damaging 1.00
R1827:Zfp84 UTSW 7 29777343 missense possibly damaging 0.91
R1854:Zfp84 UTSW 7 29775371 missense possibly damaging 0.84
R2209:Zfp84 UTSW 7 29777182 missense probably damaging 0.99
R2843:Zfp84 UTSW 7 29775333 splice site probably null
R2844:Zfp84 UTSW 7 29775333 splice site probably null
R4691:Zfp84 UTSW 7 29777080 missense probably damaging 1.00
R5474:Zfp84 UTSW 7 29777089 missense probably damaging 1.00
R5578:Zfp84 UTSW 7 29775431 missense possibly damaging 0.93
R5646:Zfp84 UTSW 7 29776393 missense probably benign 0.05
R5963:Zfp84 UTSW 7 29776953 missense probably damaging 1.00
R6830:Zfp84 UTSW 7 29776486 missense probably benign 0.00
V3553:Zfp84 UTSW 7 29777247 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- AAGCACATGGTTCTGTTTGTC -3'
(R):5'- CTGGTAGGAATTCGCACCTG -3'

Sequencing Primer
(F):5'- GCTCGCGCTGATGAACTTAC -3'
(R):5'- AGGAATTCGCACCTGTTGAG -3'
Posted On2016-10-06