Incidental Mutation 'R5453:Emsy'
ID432628
Institutional Source Beutler Lab
Gene Symbol Emsy
Ensembl Gene ENSMUSG00000035401
Gene NameEMSY, BRCA2-interacting transcriptional repressor
Synonyms2210018M11Rik
MMRRC Submission 043017-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location98587137-98656783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98600806 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 758 (K758R)
Ref Sequence ENSEMBL: ENSMUSP00000145858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038359] [ENSMUST00000205276] [ENSMUST00000205886] [ENSMUST00000205911] [ENSMUST00000206619] [ENSMUST00000206626]
Predicted Effect probably damaging
Transcript: ENSMUST00000038359
AA Change: K758R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038216
Gene: ENSMUSG00000035401
AA Change: K758R

DomainStartEndE-ValueType
ENT 16 88 2.44e-29 SMART
low complexity region 94 104 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
low complexity region 293 331 N/A INTRINSIC
low complexity region 363 406 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 681 698 N/A INTRINSIC
low complexity region 807 816 N/A INTRINSIC
low complexity region 866 882 N/A INTRINSIC
low complexity region 893 909 N/A INTRINSIC
low complexity region 1197 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205276
AA Change: K758R

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205485
Predicted Effect unknown
Transcript: ENSMUST00000205886
AA Change: K78R
Predicted Effect probably benign
Transcript: ENSMUST00000205911
Predicted Effect probably benign
Transcript: ENSMUST00000206619
Predicted Effect probably benign
Transcript: ENSMUST00000206626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206813
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,595,796 probably null Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Anxa1 C T 19: 20,380,339 probably null Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cd163 C T 6: 124,312,541 A406V probably damaging Het
Cdh13 A T 8: 119,198,967 D358V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Fam126a A G 5: 23,987,879 probably null Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hoxb3 T C 11: 96,344,654 S136P probably damaging Het
Hras A C 7: 141,192,855 V29G probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Olfr427 A G 1: 174,099,467 K3R probably benign Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Rbm47 A G 5: 66,027,182 V26A probably benign Het
Ripk2 A T 4: 16,151,989 I190N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp108 G T 7: 24,261,264 G427W probably damaging Het
Zfp84 A G 7: 29,776,297 E138G possibly damaging Het
Other mutations in Emsy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Emsy APN 7 98593455 missense probably benign 0.09
IGL01357:Emsy APN 7 98590870 nonsense probably null
IGL01620:Emsy APN 7 98626624 missense probably damaging 1.00
IGL01750:Emsy APN 7 98619301 missense probably damaging 0.99
IGL02032:Emsy APN 7 98590780 missense possibly damaging 0.94
IGL02388:Emsy APN 7 98641666 missense probably damaging 0.99
IGL03089:Emsy APN 7 98637266 nonsense probably null
IGL03272:Emsy APN 7 98593762 missense probably damaging 0.98
IGL03347:Emsy APN 7 98610685 missense probably damaging 0.99
IGL03400:Emsy APN 7 98602726 missense possibly damaging 0.94
IGL02980:Emsy UTSW 7 98619380 missense probably damaging 0.97
R0576:Emsy UTSW 7 98593776 missense probably damaging 0.99
R1102:Emsy UTSW 7 98602589 missense probably damaging 0.97
R1323:Emsy UTSW 7 98610657 splice site probably benign
R1438:Emsy UTSW 7 98621406 missense possibly damaging 0.88
R1439:Emsy UTSW 7 98600841 intron probably benign
R1452:Emsy UTSW 7 98600674 missense probably damaging 0.96
R1515:Emsy UTSW 7 98590856 missense probably damaging 1.00
R1535:Emsy UTSW 7 98593737 missense possibly damaging 0.94
R1791:Emsy UTSW 7 98647880 missense probably damaging 0.99
R1829:Emsy UTSW 7 98602729 missense possibly damaging 0.95
R1829:Emsy UTSW 7 98602730 missense possibly damaging 0.88
R1848:Emsy UTSW 7 98600821 missense probably damaging 0.99
R1861:Emsy UTSW 7 98641615 missense probably damaging 1.00
R1929:Emsy UTSW 7 98626623 missense probably damaging 0.99
R1957:Emsy UTSW 7 98647820 missense probably damaging 1.00
R2221:Emsy UTSW 7 98590775 missense possibly damaging 0.83
R2223:Emsy UTSW 7 98590775 missense possibly damaging 0.83
R2271:Emsy UTSW 7 98626623 missense probably damaging 0.99
R4078:Emsy UTSW 7 98590725 missense probably damaging 0.99
R4707:Emsy UTSW 7 98597104 missense possibly damaging 0.94
R4783:Emsy UTSW 7 98646479 missense possibly damaging 0.74
R5518:Emsy UTSW 7 98593611 missense possibly damaging 0.86
R5828:Emsy UTSW 7 98593492 missense probably benign
R5945:Emsy UTSW 7 98619383 missense probably damaging 0.97
R6153:Emsy UTSW 7 98610853 missense probably damaging 1.00
R6824:Emsy UTSW 7 98593407 missense probably benign 0.27
X0067:Emsy UTSW 7 98630240 missense possibly damaging 0.65
Z1088:Emsy UTSW 7 98600722 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTCCGCAAAGGTAGCACTAC -3'
(R):5'- GCATATGAATTATTGTAGGCTGCTG -3'

Sequencing Primer
(F):5'- GCAATGGATGGACTCTCA -3'
(R):5'- GCTGTTACATAGGCTGTAGTCTATAC -3'
Posted On2016-10-06