Incidental Mutation 'R5453:Hras'
ID432630
Institutional Source Beutler Lab
Gene Symbol Hras
Ensembl Gene ENSMUSG00000025499
Gene NameHarvey rat sarcoma virus oncogene
Synonymsras, c-rasHa, Harvey-ras, Ha-ras, Hras-1, H-ras, c-H-ras, Hras1
MMRRC Submission 043017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141189105-141194005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 141192855 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 29 (V29G)
Ref Sequence ENSEMBL: ENSMUSP00000132110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026572] [ENSMUST00000047093] [ENSMUST00000070458] [ENSMUST00000084446] [ENSMUST00000097957] [ENSMUST00000124314] [ENSMUST00000124971] [ENSMUST00000144008] [ENSMUST00000168550] [ENSMUST00000209220]
Predicted Effect probably damaging
Transcript: ENSMUST00000026572
AA Change: V29G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026572
Gene: ENSMUSG00000025499
AA Change: V29G

DomainStartEndE-ValueType
RAS 1 166 1.12e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047093
SMART Domains Protein: ENSMUSP00000048691
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_4 138 177 9.1e-8 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
low complexity region 390 404 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 474 496 N/A INTRINSIC
low complexity region 523 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070458
SMART Domains Protein: ENSMUSP00000063912
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_7 116 132 4e-2 PFAM
Pfam:LRR_8 116 171 8.7e-8 PFAM
Pfam:LRR_4 117 158 7.2e-11 PFAM
Pfam:LRR_1 139 159 2.9e-2 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
low complexity region 390 404 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 474 496 N/A INTRINSIC
low complexity region 523 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084446
SMART Domains Protein: ENSMUSP00000081486
Gene: ENSMUSG00000038637

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Pfam:LRR_7 116 132 3.5e-2 PFAM
Pfam:LRR_8 116 171 6.9e-8 PFAM
Pfam:LRR_4 117 158 6.7e-11 PFAM
Pfam:LRR_6 136 160 5.9e-2 PFAM
Pfam:LRR_1 139 159 2.6e-2 PFAM
Pfam:LRR_6 157 182 4.1e-2 PFAM
Pfam:LRR_1 161 199 5.9e-2 PFAM
LRRcap 212 230 4.44e-1 SMART
low complexity region 294 310 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097957
AA Change: V29G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095570
Gene: ENSMUSG00000025499
AA Change: V29G

DomainStartEndE-ValueType
RAS 1 166 1.12e-122 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124314
AA Change: V29G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000124971
AA Change: V29G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138189
Gene: ENSMUSG00000025499
AA Change: V29G

DomainStartEndE-ValueType
RAS 1 108 4.18e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128993
Predicted Effect probably benign
Transcript: ENSMUST00000134008
Predicted Effect probably benign
Transcript: ENSMUST00000144008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150141
Predicted Effect probably damaging
Transcript: ENSMUST00000168550
AA Change: V29G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132110
Gene: ENSMUSG00000025499
AA Change: V29G

DomainStartEndE-ValueType
RAS 1 158 4.97e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209220
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Ras oncogene family, whose members are related to the transforming genes of mammalian sarcoma retroviruses. The products encoded by these genes function in signal transduction pathways. These proteins can bind GTP and GDP, and they have intrinsic GTPase activity. This protein undergoes a continuous cycle of de- and re-palmitoylation, which regulates its rapid exchange between the plasma membrane and the Golgi apparatus. Mutations in this gene cause Costello syndrome, a disease characterized by increased growth at the prenatal stage, growth deficiency at the postnatal stage, predisposition to tumor formation, mental retardation, skin and musculoskeletal abnormalities, distinctive facial appearance and cardiovascular abnormalities. Defects in this gene are implicated in a variety of cancers, including bladder cancer, follicular thyroid cancer, and oral squamous cell carcinoma. Multiple transcript variants, which encode different isoforms, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile with no gross morphological or histological abnormalities, defects in neuronal development or defects in lymphocyte cell populations. A decreased susceptibility to DMBA induced skin papillomas was also demonstrated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,595,796 probably null Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Anxa1 C T 19: 20,380,339 probably null Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cd163 C T 6: 124,312,541 A406V probably damaging Het
Cdh13 A T 8: 119,198,967 D358V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Emsy T C 7: 98,600,806 K758R probably damaging Het
Fam126a A G 5: 23,987,879 probably null Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hoxb3 T C 11: 96,344,654 S136P probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Olfr427 A G 1: 174,099,467 K3R probably benign Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Rbm47 A G 5: 66,027,182 V26A probably benign Het
Ripk2 A T 4: 16,151,989 I190N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp108 G T 7: 24,261,264 G427W probably damaging Het
Zfp84 A G 7: 29,776,297 E138G possibly damaging Het
Other mutations in Hras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Hras APN 7 141192870 missense possibly damaging 0.84
R5330:Hras UTSW 7 141192940 start codon destroyed probably null 0.91
R5331:Hras UTSW 7 141192940 start codon destroyed probably null 0.91
R5924:Hras UTSW 7 141192461 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAACAACACGGCTTAGTGGG -3'
(R):5'- TAGCCGTCTCAAGTGGCAAG -3'

Sequencing Primer
(F):5'- GGGGTCTCACCTCTCCTCAG -3'
(R):5'- CAAGGGCCTTGGCTAAGTG -3'
Posted On2016-10-06