Incidental Mutation 'R5453:Cdh13'
ID432632
Institutional Source Beutler Lab
Gene Symbol Cdh13
Ensembl Gene ENSMUSG00000031841
Gene Namecadherin 13
SynonymsT-cadherin, 4932416G01Rik, Tcad
MMRRC Submission 043017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location118283733-119324921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119198967 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 358 (D358V)
Ref Sequence ENSEMBL: ENSMUSP00000113527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117160]
PDB Structure
Crystal Structure of mouse T-cadherin EC1 EC2 [X-RAY DIFFRACTION]
Crystal structure of mouse T-cadherin EC1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000117160
AA Change: D358V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113527
Gene: ENSMUSG00000031841
AA Change: D358V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Cadherin_pro 26 112 1.04e-17 SMART
CA 160 243 1.49e-18 SMART
CA 267 361 1.84e-23 SMART
CA 383 476 8.75e-16 SMART
CA 499 583 2.36e-21 SMART
CA 604 687 5.93e-2 SMART
low complexity region 695 714 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212476
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is highly expressed in the vasculature including endothelial cells, smooth muscle cells and pericytes, where the encoded protein binds to adiponectin and has been implicated in the modulation of angiogenesis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased retinal neovascularization and increased adiponectin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,595,796 probably null Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Anxa1 C T 19: 20,380,339 probably null Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cd163 C T 6: 124,312,541 A406V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Emsy T C 7: 98,600,806 K758R probably damaging Het
Fam126a A G 5: 23,987,879 probably null Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hoxb3 T C 11: 96,344,654 S136P probably damaging Het
Hras A C 7: 141,192,855 V29G probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Olfr427 A G 1: 174,099,467 K3R probably benign Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Rbm47 A G 5: 66,027,182 V26A probably benign Het
Ripk2 A T 4: 16,151,989 I190N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp108 G T 7: 24,261,264 G427W probably damaging Het
Zfp84 A G 7: 29,776,297 E138G possibly damaging Het
Other mutations in Cdh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Cdh13 APN 8 119312506 missense possibly damaging 0.87
IGL00659:Cdh13 APN 8 119312667 missense probably damaging 1.00
IGL01662:Cdh13 APN 8 118675177 missense probably damaging 0.99
IGL01719:Cdh13 APN 8 118675188 missense probably benign 0.01
IGL02148:Cdh13 APN 8 119198958 missense probably damaging 1.00
IGL02157:Cdh13 APN 8 118505671 missense possibly damaging 0.68
IGL02188:Cdh13 APN 8 118851761 missense probably benign 0.08
IGL02490:Cdh13 APN 8 119095323 missense probably damaging 1.00
IGL02851:Cdh13 APN 8 118675158 missense probably benign 0.32
IGL02958:Cdh13 APN 8 119312721 missense possibly damaging 0.90
IGL03085:Cdh13 APN 8 119288724 missense probably damaging 1.00
IGL03230:Cdh13 APN 8 119242317 missense probably damaging 1.00
IGL03280:Cdh13 APN 8 119314134 missense probably damaging 1.00
K3955:Cdh13 UTSW 8 118675104 missense probably damaging 0.99
P0038:Cdh13 UTSW 8 118675104 missense probably damaging 0.99
R0398:Cdh13 UTSW 8 119314047 missense probably damaging 1.00
R2156:Cdh13 UTSW 8 119236964 missense probably damaging 1.00
R3415:Cdh13 UTSW 8 118675207 missense probably benign 0.35
R4243:Cdh13 UTSW 8 119242257 missense probably damaging 1.00
R4839:Cdh13 UTSW 8 118851848 nonsense probably null
R4851:Cdh13 UTSW 8 118757390 missense possibly damaging 0.75
R5129:Cdh13 UTSW 8 119095215 missense probably damaging 1.00
R5607:Cdh13 UTSW 8 118757474 missense probably benign
R5608:Cdh13 UTSW 8 118757474 missense probably benign
R5610:Cdh13 UTSW 8 118851723 missense possibly damaging 0.95
R6035:Cdh13 UTSW 8 118505698 missense probably benign 0.03
R6035:Cdh13 UTSW 8 118505698 missense probably benign 0.03
R6556:Cdh13 UTSW 8 118968187 missense probably damaging 0.99
X0025:Cdh13 UTSW 8 118505679 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ATGGTCAGTTATGGATGCCTGC -3'
(R):5'- GACTCACATCACACAGTCCTTTG -3'

Sequencing Primer
(F):5'- CATAGGGAACATGCTCGCTAGTTTTC -3'
(R):5'- CACAGTCCTTTGGAAATGGC -3'
Posted On2016-10-06