Incidental Mutation 'R5453:Hoxb3'
ID432639
Institutional Source Beutler Lab
Gene Symbol Hoxb3
Ensembl Gene ENSMUSG00000048763
Gene Namehomeobox B3
SynonymsHox-2.7
MMRRC Submission 043017-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location96323326-96347930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96344654 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 136 (S136P)
Ref Sequence ENSEMBL: ENSMUSP00000091476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055334] [ENSMUST00000093944] [ENSMUST00000123091]
Predicted Effect probably damaging
Transcript: ENSMUST00000055334
AA Change: S136P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053426
Gene: ENSMUSG00000048763
AA Change: S136P

DomainStartEndE-ValueType
low complexity region 76 121 N/A INTRINSIC
low complexity region 154 181 N/A INTRINSIC
HOX 191 253 5.44e-28 SMART
low complexity region 256 274 N/A INTRINSIC
Pfam:DUF4074 367 431 9.4e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093944
AA Change: S136P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091476
Gene: ENSMUSG00000048763
AA Change: S136P

DomainStartEndE-ValueType
low complexity region 76 121 N/A INTRINSIC
low complexity region 154 181 N/A INTRINSIC
HOX 191 253 5.44e-28 SMART
low complexity region 256 274 N/A INTRINSIC
Pfam:DUF4074 368 431 1.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147410
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Increased expression of this gene is associated with a distinct biologic subset of acute myeloid leukemia (AML). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial neonatal lethality and mild and low penetrance defects in the formation of the anterior arch of the atlas and the IXth cranial nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,595,796 probably null Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Anxa1 C T 19: 20,380,339 probably null Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cd163 C T 6: 124,312,541 A406V probably damaging Het
Cdh13 A T 8: 119,198,967 D358V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Emsy T C 7: 98,600,806 K758R probably damaging Het
Fam126a A G 5: 23,987,879 probably null Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hras A C 7: 141,192,855 V29G probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Olfr427 A G 1: 174,099,467 K3R probably benign Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Rbm47 A G 5: 66,027,182 V26A probably benign Het
Ripk2 A T 4: 16,151,989 I190N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp108 G T 7: 24,261,264 G427W probably damaging Het
Zfp84 A G 7: 29,776,297 E138G possibly damaging Het
Other mutations in Hoxb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Hoxb3 APN 11 96346160 missense probably damaging 1.00
R0082:Hoxb3 UTSW 11 96344271 missense probably damaging 1.00
R0621:Hoxb3 UTSW 11 96345963 missense probably damaging 1.00
R0701:Hoxb3 UTSW 11 96346248 nonsense probably null
R2205:Hoxb3 UTSW 11 96345668 missense probably benign
R4093:Hoxb3 UTSW 11 96346100 missense probably damaging 0.99
R4620:Hoxb3 UTSW 11 96345773 missense probably damaging 0.96
R6180:Hoxb3 UTSW 11 96346103 missense probably benign 0.03
U24488:Hoxb3 UTSW 11 96344630 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCAATGGCAGCTGCATGAG -3'
(R):5'- TCAGAGGTCATCAGGTAGTGAG -3'

Sequencing Primer
(F):5'- AGCTGCATGAGGCCAGG -3'
(R):5'- TCATCAGGTAGTGAGAGGTAGC -3'
Posted On2016-10-06