Incidental Mutation 'R5453:Anxa1'
ID432647
Institutional Source Beutler Lab
Gene Symbol Anxa1
Ensembl Gene ENSMUSG00000024659
Gene Nameannexin A1
SynonymsC430014K04Rik, Anx-A1, Lpc1, Anx-1, Lpc-1
MMRRC Submission 043017-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location20373428-20390944 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 20380339 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025561]
Predicted Effect probably null
Transcript: ENSMUST00000025561
SMART Domains Protein: ENSMUSP00000025561
Gene: ENSMUSG00000024659

DomainStartEndE-ValueType
ANX 59 111 4.45e-21 SMART
ANX 131 183 3.9e-26 SMART
ANX 215 267 4.86e-13 SMART
ANX 290 342 2.26e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171423
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-localized protein that binds phospholipids. This protein inhibits phospholipase A2 and has anti-inflammatory activity. Loss of function or expression of this gene has been detected in multiple tumors. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mutations in this gene result in increased inflammatory response and decreased macrophage activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,595,796 probably null Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cd163 C T 6: 124,312,541 A406V probably damaging Het
Cdh13 A T 8: 119,198,967 D358V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Emsy T C 7: 98,600,806 K758R probably damaging Het
Fam126a A G 5: 23,987,879 probably null Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hoxb3 T C 11: 96,344,654 S136P probably damaging Het
Hras A C 7: 141,192,855 V29G probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Olfr427 A G 1: 174,099,467 K3R probably benign Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Rbm47 A G 5: 66,027,182 V26A probably benign Het
Ripk2 A T 4: 16,151,989 I190N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp108 G T 7: 24,261,264 G427W probably damaging Het
Zfp84 A G 7: 29,776,297 E138G possibly damaging Het
Other mutations in Anxa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Anxa1 APN 19 20377669 missense probably benign 0.01
IGL03234:Anxa1 APN 19 20377601 splice site probably benign
R0058:Anxa1 UTSW 19 20383777 missense probably damaging 1.00
R0058:Anxa1 UTSW 19 20383777 missense probably damaging 1.00
R1446:Anxa1 UTSW 19 20373739 missense probably damaging 1.00
R1864:Anxa1 UTSW 19 20379689 missense probably benign 0.00
R2213:Anxa1 UTSW 19 20382875 missense probably damaging 1.00
R4787:Anxa1 UTSW 19 20373754 missense probably damaging 0.98
R5013:Anxa1 UTSW 19 20382923 missense probably benign 0.02
R5468:Anxa1 UTSW 19 20378483 missense probably damaging 1.00
R5918:Anxa1 UTSW 19 20378493 splice site probably benign
R6059:Anxa1 UTSW 19 20377700 missense possibly damaging 0.91
R6379:Anxa1 UTSW 19 20373715 makesense probably null
R6394:Anxa1 UTSW 19 20383849 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGGCGTTACTATACAGTAAG -3'
(R):5'- TGTAACTGATACTCTGGGACAAATG -3'

Sequencing Primer
(F):5'- GGCGTTACTATACAGTAAGAGAAATG -3'
(R):5'- CTGATACTCTGGGACAAATGTTTAAG -3'
Posted On2016-10-06