Incidental Mutation 'R5455:Stxbp5'
ID432719
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Namesyntaxin binding protein 5 (tomosyn)
Synonyms4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location9755547-9901079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9808508 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 573 (S573P)
Ref Sequence ENSEMBL: ENSMUSP00000123253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]
Predicted Effect probably benign
Transcript: ENSMUST00000038213
AA Change: S573P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: S573P

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000125200
AA Change: S573P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: S573P

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000141722
AA Change: S573P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: S573P

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9799950 missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9808602 splice site probably benign
IGL01725:Stxbp5 APN 10 9817411 missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9762821 missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9816297 missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9762956 nonsense probably null
IGL02720:Stxbp5 APN 10 9789361 critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9816290 missense probably null 1.00
IGL03288:Stxbp5 APN 10 9866703 splice site probably null
Fatty_fish UTSW 10 9770551 missense probably damaging 1.00
reindeer UTSW 10 9838092 missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9769443 missense probably benign 0.36
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9770528 missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9866698 splice site probably benign
R0631:Stxbp5 UTSW 10 9784358 missense probably benign
R0723:Stxbp5 UTSW 10 9768873 missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9809040 missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9812391 missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9816269 missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9838092 missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9835846 missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9768927 missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9769419 missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9789316 intron probably benign
R4572:Stxbp5 UTSW 10 9838144 missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9770623 missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9812341 nonsense probably null
R4887:Stxbp5 UTSW 10 9809100 missense probably benign
R4930:Stxbp5 UTSW 10 9760866 utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9770551 missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9798275 critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9799991 missense probably damaging 1.00
R5531:Stxbp5 UTSW 10 9762924 nonsense probably null
R5605:Stxbp5 UTSW 10 9769746 intron probably benign
R5614:Stxbp5 UTSW 10 9760894 utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9900586 missense probably benign
R5990:Stxbp5 UTSW 10 9835933 missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9800028 missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9770686 missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9808472 missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9817339 missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9767179 missense probably benign 0.32
R6284:Stxbp5 UTSW 10 9767187 missense probably damaging 1.00
R6394:Stxbp5 UTSW 10 9899231 nonsense probably null
R6427:Stxbp5 UTSW 10 9899254 missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9784361 missense probably benign 0.00
X0020:Stxbp5 UTSW 10 9762890 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GCACCCATTCTTATAGGAAACTG -3'
(R):5'- GGTCACACCTGTGTACACAAG -3'

Sequencing Primer
(F):5'- CCCATTCTTATAGGAAACTGCTATTG -3'
(R):5'- CACCTGTGTACACAAGTCTTTACAAG -3'
Posted On2016-10-06