Incidental Mutation 'R5455:Olfr1352'
ID432723
Institutional Source Beutler Lab
Gene Symbol Olfr1352
Ensembl Gene ENSMUSG00000046493
Gene Nameolfactory receptor 1352
SynonymsMOR139-1, GA_x6K02T2QGN0-2828447-2827518
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78981050-78987903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78984537 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 249 (S249F)
Ref Sequence ENSEMBL: ENSMUSP00000054355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058991] [ENSMUST00000203973]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058991
AA Change: S249F

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054355
Gene: ENSMUSG00000046493
AA Change: S249F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 305 9.1e-6 PFAM
Pfam:7tm_1 41 290 4.7e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203973
SMART Domains Protein: ENSMUSP00000144895
Gene: ENSMUSG00000046493

DomainStartEndE-ValueType
Pfam:7tm_4 1 122 6.1e-25 PFAM
Pfam:7TM_GPCR_Srx 1 123 7.5e-5 PFAM
Pfam:7TM_GPCR_Srsx 2 123 4.5e-8 PFAM
Pfam:7tm_1 8 123 2.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219714
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Olfr1352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Olfr1352 APN 10 78983862 missense probably damaging 0.96
IGL01865:Olfr1352 APN 10 78984678 missense possibly damaging 0.94
R0196:Olfr1352 UTSW 10 78984189 missense possibly damaging 0.89
R0362:Olfr1352 UTSW 10 78984386 missense probably benign 0.00
R1574:Olfr1352 UTSW 10 78983986 missense probably damaging 1.00
R1574:Olfr1352 UTSW 10 78983986 missense probably damaging 1.00
R2982:Olfr1352 UTSW 10 78984440 missense probably damaging 1.00
R4724:Olfr1352 UTSW 10 78984522 missense probably damaging 1.00
R5000:Olfr1352 UTSW 10 78984680 missense probably benign 0.00
R5085:Olfr1352 UTSW 10 78984094 missense probably benign 0.03
R5145:Olfr1352 UTSW 10 78984309 missense probably benign 0.35
R5777:Olfr1352 UTSW 10 78984678 missense possibly damaging 0.78
R5822:Olfr1352 UTSW 10 78984189 missense possibly damaging 0.89
R6283:Olfr1352 UTSW 10 78984279 missense probably benign 0.01
R7242:Olfr1352 UTSW 10 78984497 nonsense probably null
R7504:Olfr1352 UTSW 10 78984660 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TCTGTGAATTGAATCAGGTGGC -3'
(R):5'- ACTCATAGTTTTACCCCTAAGAGCC -3'

Sequencing Primer
(F):5'- AGCTAACCTGTTCTGACACC -3'
(R):5'- TACCCCTAAGAGCCTCTTCAGG -3'
Posted On2016-10-06