Incidental Mutation 'R5455:Zpbp2'
ID432726
Institutional Source Beutler Lab
Gene Symbol Zpbp2
Ensembl Gene ENSMUSG00000017195
Gene Namezona pellucida binding protein 2
Synonyms1700017D11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98551097-98558665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98557603 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 249 (V249L)
Ref Sequence ENSEMBL: ENSMUSP00000103137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017339] [ENSMUST00000081033] [ENSMUST00000107509] [ENSMUST00000107511] [ENSMUST00000107513]
Predicted Effect probably benign
Transcript: ENSMUST00000017339
AA Change: V271L

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000017339
Gene: ENSMUSG00000017195
AA Change: V271L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sp38 55 326 9.6e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081033
AA Change: V198L

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000079822
Gene: ENSMUSG00000017195
AA Change: V198L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sp38 55 135 2e-35 PFAM
Pfam:Sp38 134 253 1.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107509
AA Change: V217L

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103133
Gene: ENSMUSG00000017195
AA Change: V217L

DomainStartEndE-ValueType
Pfam:Sp38 1 272 1.1e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107511
AA Change: V217L

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103135
Gene: ENSMUSG00000017195
AA Change: V217L

DomainStartEndE-ValueType
Pfam:Sp38 1 272 1.1e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107513
AA Change: V249L

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103137
Gene: ENSMUSG00000017195
AA Change: V249L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Sp38 33 304 4.5e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126236
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display reduced fecundity, mild teratozoospermia, and delayed fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Other mutations in Zpbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Zpbp2 APN 11 98557592 missense probably damaging 1.00
IGL02127:Zpbp2 APN 11 98555541 missense probably damaging 0.97
IGL02612:Zpbp2 APN 11 98555517 missense probably benign 0.01
R0709:Zpbp2 UTSW 11 98553937 missense probably damaging 1.00
R0959:Zpbp2 UTSW 11 98557625 missense probably benign 0.16
R1445:Zpbp2 UTSW 11 98553844 missense probably damaging 1.00
R2032:Zpbp2 UTSW 11 98554708 missense probably damaging 1.00
R3621:Zpbp2 UTSW 11 98552556 missense probably benign 0.08
R4328:Zpbp2 UTSW 11 98557606 missense probably benign 0.06
R4685:Zpbp2 UTSW 11 98551291 intron probably benign
R4957:Zpbp2 UTSW 11 98551324 critical splice donor site probably null
R5395:Zpbp2 UTSW 11 98558213 missense probably damaging 1.00
R5633:Zpbp2 UTSW 11 98554758 missense probably damaging 1.00
R5792:Zpbp2 UTSW 11 98551410 intron probably benign
R5837:Zpbp2 UTSW 11 98551271 start gained probably benign
R7073:Zpbp2 UTSW 11 98552509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGGCCTGTGATTCATGAG -3'
(R):5'- AGAACACGGTGGAAATGTTTTG -3'

Sequencing Primer
(F):5'- CCTGTGATTCATGAGAAGGATTTTG -3'
(R):5'- ATTGCTGTGCAGACCTTC -3'
Posted On2016-10-06