Incidental Mutation 'R5455:Synpo2l'
ID432729
Institutional Source Beutler Lab
Gene Symbol Synpo2l
Ensembl Gene ENSMUSG00000039376
Gene Namesynaptopodin 2-like
Synonyms1110054M18Rik, Chap
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20658946-20668354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20662292 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 87 (A87S)
Ref Sequence ENSEMBL: ENSMUSP00000112760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057090] [ENSMUST00000117386] [ENSMUST00000119483]
Predicted Effect probably damaging
Transcript: ENSMUST00000057090
AA Change: A313S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053176
Gene: ENSMUSG00000039376
AA Change: A313S

DomainStartEndE-ValueType
PDZ 15 85 3.52e-10 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 151 162 N/A INTRINSIC
low complexity region 202 230 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 563 580 N/A INTRINSIC
low complexity region 591 604 N/A INTRINSIC
low complexity region 700 726 N/A INTRINSIC
low complexity region 781 797 N/A INTRINSIC
low complexity region 867 880 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117386
AA Change: A316S

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112792
Gene: ENSMUSG00000039376
AA Change: A316S

DomainStartEndE-ValueType
PDZ 15 88 1.34e-15 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 154 165 N/A INTRINSIC
low complexity region 205 233 N/A INTRINSIC
low complexity region 246 260 N/A INTRINSIC
low complexity region 432 447 N/A INTRINSIC
low complexity region 503 521 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 566 583 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 703 729 N/A INTRINSIC
low complexity region 784 800 N/A INTRINSIC
low complexity region 870 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119483
AA Change: A87S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112760
Gene: ENSMUSG00000039376
AA Change: A87S

DomainStartEndE-ValueType
low complexity region 203 218 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 365 378 N/A INTRINSIC
low complexity region 474 500 N/A INTRINSIC
low complexity region 555 571 N/A INTRINSIC
low complexity region 641 654 N/A INTRINSIC
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Synpo2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0048:Synpo2l UTSW 14 20666272 unclassified probably benign
R0277:Synpo2l UTSW 14 20661788 missense probably damaging 1.00
R0440:Synpo2l UTSW 14 20661398 missense possibly damaging 0.89
R0540:Synpo2l UTSW 14 20660680 missense probably damaging 1.00
R0607:Synpo2l UTSW 14 20660680 missense probably damaging 1.00
R0712:Synpo2l UTSW 14 20661839 missense probably damaging 1.00
R1175:Synpo2l UTSW 14 20668167 missense possibly damaging 0.93
R1563:Synpo2l UTSW 14 20661278 missense probably damaging 1.00
R1729:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R1730:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R1739:Synpo2l UTSW 14 20665819 missense probably damaging 1.00
R2199:Synpo2l UTSW 14 20661919 missense probably benign 0.00
R2213:Synpo2l UTSW 14 20660666 missense probably damaging 1.00
R3085:Synpo2l UTSW 14 20662180 missense probably damaging 1.00
R4787:Synpo2l UTSW 14 20661697 missense possibly damaging 0.49
R5256:Synpo2l UTSW 14 20661014 missense probably benign 0.00
R5454:Synpo2l UTSW 14 20662292 missense probably damaging 0.99
R5765:Synpo2l UTSW 14 20666130 missense possibly damaging 0.95
R5950:Synpo2l UTSW 14 20665935 missense probably benign 0.00
R6376:Synpo2l UTSW 14 20660634 missense probably damaging 1.00
R6438:Synpo2l UTSW 14 20661136 missense probably benign 0.00
R6440:Synpo2l UTSW 14 20668176 missense probably damaging 0.98
R6511:Synpo2l UTSW 14 20662450 missense probably damaging 1.00
R6834:Synpo2l UTSW 14 20660634 missense probably damaging 1.00
Z1088:Synpo2l UTSW 14 20665967 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACTCTCTGCTGTGCCTAAG -3'
(R):5'- CAGGATTAGAACAGGCCGTG -3'

Sequencing Primer
(F):5'- TGTGCCTAAGCCAGCCCTAG -3'
(R):5'- GTGAAGCCCCCTGATTGATC -3'
Posted On2016-10-06