Incidental Mutation 'R5455:Vstm4'
ID432731
Institutional Source Beutler Lab
Gene Symbol Vstm4
Ensembl Gene ENSMUSG00000050666
Gene NameV-set and transmembrane domain containing 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32856756-32939491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32863878 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 134 (H134R)
Ref Sequence ENSEMBL: ENSMUSP00000055178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053175]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053175
AA Change: H134R

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055178
Gene: ENSMUSG00000050666
AA Change: H134R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 31 153 2.11e-2 SMART
transmembrane domain 178 200 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Vstm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Vstm4 APN 14 32919245 missense probably benign 0.08
IGL02720:Vstm4 APN 14 32863617 missense probably damaging 0.99
IGL02927:Vstm4 APN 14 32937788 missense probably damaging 0.99
R0122:Vstm4 UTSW 14 32863811 unclassified probably null
R0755:Vstm4 UTSW 14 32892644 missense probably damaging 1.00
R1508:Vstm4 UTSW 14 32863554 missense probably damaging 1.00
R2075:Vstm4 UTSW 14 32917854 missense probably damaging 1.00
R2517:Vstm4 UTSW 14 32863707 missense probably benign 0.02
R3087:Vstm4 UTSW 14 32892635 missense possibly damaging 0.46
R3870:Vstm4 UTSW 14 32863755 missense probably benign 0.43
R4463:Vstm4 UTSW 14 32917876 missense probably damaging 1.00
R4731:Vstm4 UTSW 14 32917902 missense possibly damaging 0.60
R4732:Vstm4 UTSW 14 32917902 missense possibly damaging 0.60
R4733:Vstm4 UTSW 14 32917902 missense possibly damaging 0.60
R4860:Vstm4 UTSW 14 32863785 missense possibly damaging 0.84
R4860:Vstm4 UTSW 14 32863785 missense possibly damaging 0.84
R4983:Vstm4 UTSW 14 32919245 missense probably benign 0.08
R5059:Vstm4 UTSW 14 32863730 missense probably damaging 0.98
R5593:Vstm4 UTSW 14 32919290 missense probably benign 0.08
R5771:Vstm4 UTSW 14 32904569 missense probably benign 0.28
R6018:Vstm4 UTSW 14 32863670 missense probably benign 0.25
R6927:Vstm4 UTSW 14 32864002 intron probably null
X0064:Vstm4 UTSW 14 32863721 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTTGATGGTGAAGATGACG -3'
(R):5'- TAACTTGACTCACAGGCATTTGG -3'

Sequencing Primer
(F):5'- TGACGAAGCTCCGGATAATTC -3'
(R):5'- ATTTGGCCCACAGAGGC -3'
Posted On2016-10-06