Incidental Mutation 'R5455:Pced1b'
ID432733
Institutional Source Beutler Lab
Gene Symbol Pced1b
Ensembl Gene ENSMUSG00000044250
Gene NamePC-esterase domain containing 1B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location97247107-97385680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 97384393 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 104 (S104R)
Ref Sequence ENSEMBL: ENSMUSP00000154814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059433] [ENSMUST00000226495] [ENSMUST00000228521]
Predicted Effect probably benign
Transcript: ENSMUST00000059433
AA Change: S104R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000055485
Gene: ENSMUSG00000044250
AA Change: S104R

DomainStartEndE-ValueType
Pfam:PC-Esterase 1 254 5.1e-53 PFAM
low complexity region 295 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226495
Predicted Effect probably benign
Transcript: ENSMUST00000228521
AA Change: S104R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the GDSL/SGNH-like acyl-esterase family. Members of this family are hydrolases thought to function in modification of biopolymers on the cell surface. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Pced1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1661:Pced1b UTSW 15 97384713 missense probably benign 0.01
R1699:Pced1b UTSW 15 97384877 missense probably damaging 1.00
R2115:Pced1b UTSW 15 97384624 nonsense probably null
R2441:Pced1b UTSW 15 97384285 missense possibly damaging 0.60
R3154:Pced1b UTSW 15 97384542 unclassified probably null
R3907:Pced1b UTSW 15 97384550 missense probably damaging 1.00
R4712:Pced1b UTSW 15 97384794 missense probably benign 0.03
R5902:Pced1b UTSW 15 97385089 nonsense probably null
R5936:Pced1b UTSW 15 97385180 missense possibly damaging 0.59
R5936:Pced1b UTSW 15 97385182 nonsense probably null
R5988:Pced1b UTSW 15 97384347 missense probably damaging 1.00
R6525:Pced1b UTSW 15 97384798 missense possibly damaging 0.91
R6868:Pced1b UTSW 15 97384341 missense probably damaging 1.00
R7128:Pced1b UTSW 15 97384598 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGATTGCCTGCTCACTAAC -3'
(R):5'- TCTTGTCACCCAAAGGCATAGC -3'

Sequencing Primer
(F):5'- TGCTCACTAACAAGCAGCTCAGG -3'
(R):5'- AGGCATAGCAGTGTTCCAC -3'
Posted On2016-10-06