Incidental Mutation 'R5455:H2-Q6'
ID432737
Institutional Source Beutler Lab
Gene Symbol H2-Q6
Ensembl Gene ENSMUSG00000073409
Gene Namehistocompatibility 2, Q region locus 6
Synonyms0610037M15Rik, Qa6, H-2Q6, Qa-6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R5455 (G1)
Quality Score160
Status Not validated
Chromosome17
Chromosomal Location35424850-35430055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35424884 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 3 (L3P)
Ref Sequence ENSEMBL: ENSMUSP00000134550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113879] [ENSMUST00000174699]
Predicted Effect unknown
Transcript: ENSMUST00000113879
AA Change: L3P
SMART Domains Protein: ENSMUSP00000109511
Gene: ENSMUSG00000073409
AA Change: L3P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 2.1e-92 PFAM
IGc1 219 290 7.68e-23 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174699
AA Change: L3P
SMART Domains Protein: ENSMUSP00000134550
Gene: ENSMUSG00000073409
AA Change: L3P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.1e-93 PFAM
IGc1 219 290 7.68e-23 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls a lymph node and splenic lymphocyte antigen detected by BALB/cBy anti-ORA1-a tumor antibody. The strain distribution for presence/absence of antigen varies widely among inbred strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in H2-Q6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02505:H2-Q6 APN 17 35425176 missense probably benign 0.06
PIT4508001:H2-Q6 UTSW 17 35425820 missense probably damaging 1.00
R0499:H2-Q6 UTSW 17 35425203 missense probably damaging 0.98
R2426:H2-Q6 UTSW 17 35424937 missense probably benign 0.06
R3236:H2-Q6 UTSW 17 35425700 missense probably damaging 0.99
R3237:H2-Q6 UTSW 17 35425700 missense probably damaging 0.99
R3810:H2-Q6 UTSW 17 35425781 missense probably damaging 1.00
R3827:H2-Q6 UTSW 17 35425679 missense probably damaging 1.00
R3932:H2-Q6 UTSW 17 35425566 splice site probably benign
R4030:H2-Q6 UTSW 17 35425816 missense probably benign 0.00
R4529:H2-Q6 UTSW 17 35425844 missense probably null 1.00
R4558:H2-Q6 UTSW 17 35428315 missense probably benign 0.00
R5100:H2-Q6 UTSW 17 35425320 missense probably benign 0.00
R5435:H2-Q6 UTSW 17 35425685 missense probably damaging 1.00
R5724:H2-Q6 UTSW 17 35425652 missense probably damaging 1.00
R6383:H2-Q6 UTSW 17 35428383 critical splice donor site probably null
R6752:H2-Q6 UTSW 17 35428127 missense probably damaging 0.96
R6853:H2-Q6 UTSW 17 35428359 makesense probably null
X0057:H2-Q6 UTSW 17 35425593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACCTGGGTCAGTTCATTCTG -3'
(R):5'- GAAATACCGCAGCGAGTGTG -3'

Sequencing Primer
(F):5'- AGTTCATTCTGCCAGGACACTG -3'
(R):5'- TGAGACCCCGACCTCCTC -3'
Posted On2016-10-06