Incidental Mutation 'R5455:Cyp2c40'
ID432741
Institutional Source Beutler Lab
Gene Symbol Cyp2c40
Ensembl Gene ENSMUSG00000025004
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 40
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location39767071-39812814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39803792 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 236 (I236T)
Ref Sequence ENSEMBL: ENSMUSP00000125217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160476] [ENSMUST00000162507] [ENSMUST00000162630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000160476
AA Change: I236T

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125217
Gene: ENSMUSG00000025004
AA Change: I236T

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Pfam:p450 59 516 9.8e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162434
Predicted Effect probably benign
Transcript: ENSMUST00000162507
SMART Domains Protein: ENSMUSP00000124618
Gene: ENSMUSG00000025004

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 120 3.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162630
SMART Domains Protein: ENSMUSP00000123884
Gene: ENSMUSG00000025004

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Pfam:p450 59 193 6.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163090
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Cyp2c40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Cyp2c40 APN 19 39812583 missense probably benign 0.17
IGL01660:Cyp2c40 APN 19 39786810 missense probably damaging 0.99
IGL01897:Cyp2c40 APN 19 39803773 nonsense probably null
IGL01926:Cyp2c40 APN 19 39802655 missense probably benign 0.25
IGL02078:Cyp2c40 APN 19 39767482 missense probably benign 0.01
IGL02259:Cyp2c40 APN 19 39803802 missense probably benign 0.00
IGL02716:Cyp2c40 APN 19 39807536 missense possibly damaging 0.49
R0269:Cyp2c40 UTSW 19 39773896 missense probably damaging 1.00
R0308:Cyp2c40 UTSW 19 39777988 missense probably damaging 1.00
R0309:Cyp2c40 UTSW 19 39778051 missense possibly damaging 0.51
R0441:Cyp2c40 UTSW 19 39807163 splice site probably benign
R1068:Cyp2c40 UTSW 19 39812581 missense possibly damaging 0.93
R1123:Cyp2c40 UTSW 19 39812677 missense probably benign 0.00
R1443:Cyp2c40 UTSW 19 39777971 missense possibly damaging 0.90
R1506:Cyp2c40 UTSW 19 39777999 missense probably damaging 0.96
R1567:Cyp2c40 UTSW 19 39803771 missense probably null 0.99
R1731:Cyp2c40 UTSW 19 39812689 missense probably damaging 1.00
R1774:Cyp2c40 UTSW 19 39786806 missense probably damaging 1.00
R1861:Cyp2c40 UTSW 19 39786875 missense probably benign 0.11
R1977:Cyp2c40 UTSW 19 39778041 missense probably damaging 1.00
R2022:Cyp2c40 UTSW 19 39812780 unclassified probably benign
R2063:Cyp2c40 UTSW 19 39786780 missense probably benign 0.01
R2359:Cyp2c40 UTSW 19 39777954 missense probably damaging 1.00
R2413:Cyp2c40 UTSW 19 39803887 nonsense probably null
R3685:Cyp2c40 UTSW 19 39786779 missense possibly damaging 0.95
R4080:Cyp2c40 UTSW 19 39802529 missense probably benign 0.01
R4614:Cyp2c40 UTSW 19 39803856 missense probably damaging 1.00
R4661:Cyp2c40 UTSW 19 39786846 missense probably benign 0.00
R4716:Cyp2c40 UTSW 19 39802661 splice site probably null
R4799:Cyp2c40 UTSW 19 39773849 missense probably damaging 1.00
R5133:Cyp2c40 UTSW 19 39807219 missense probably benign 0.02
R5191:Cyp2c40 UTSW 19 39802591 missense probably damaging 0.96
R5310:Cyp2c40 UTSW 19 39778030 missense probably damaging 1.00
R5619:Cyp2c40 UTSW 19 39803784 missense probably damaging 1.00
R5989:Cyp2c40 UTSW 19 39807580 missense probably benign 0.45
R6175:Cyp2c40 UTSW 19 39812560 missense probably benign 0.00
R6622:Cyp2c40 UTSW 19 39802546 missense probably damaging 1.00
R6987:Cyp2c40 UTSW 19 39812767 unclassified probably benign
R7057:Cyp2c40 UTSW 19 39807619 missense probably damaging 1.00
R7485:Cyp2c40 UTSW 19 39807606 nonsense probably null
R7560:Cyp2c40 UTSW 19 39807214 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGCTGAGGGTTTCAAACTCC -3'
(R):5'- GCATGTAAGTACCTAGCAGTTAAG -3'

Sequencing Primer
(F):5'- GCTGAGGGTTTCAAACTCCATTTCAG -3'
(R):5'- GTACCTTATCATGTTAACAAGGGC -3'
Posted On2016-10-06