Incidental Mutation 'R5456:Usp31'
ID432754
Institutional Source Beutler Lab
Gene Symbol Usp31
Ensembl Gene ENSMUSG00000063317
Gene Nameubiquitin specific peptidase 31
Synonyms
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location121642021-121707253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121670277 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 481 (D481G)
Ref Sequence ENSEMBL: ENSMUSP00000040037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046929]
Predicted Effect probably damaging
Transcript: ENSMUST00000046929
AA Change: D481G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040037
Gene: ENSMUSG00000063317
AA Change: D481G

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 29 58 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 90 120 N/A INTRINSIC
Pfam:UCH 122 755 2.5e-64 PFAM
Pfam:UCH_1 562 737 1.3e-12 PFAM
low complexity region 763 777 N/A INTRINSIC
low complexity region 792 811 N/A INTRINSIC
low complexity region 831 847 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
low complexity region 1009 1030 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1072 1127 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1192 1204 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205473
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Usp31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Usp31 APN 7 121706670 missense probably damaging 1.00
IGL00421:Usp31 APN 7 121648650 missense probably damaging 0.96
IGL00657:Usp31 APN 7 121648231 missense probably benign 0.00
IGL01917:Usp31 APN 7 121679485 missense probably benign 0.26
IGL02444:Usp31 APN 7 121679495 missense probably damaging 1.00
IGL03090:Usp31 APN 7 121679530 splice site probably benign
R0334:Usp31 UTSW 7 121658962 missense probably damaging 0.99
R0945:Usp31 UTSW 7 121670253 missense probably damaging 1.00
R1326:Usp31 UTSW 7 121648302 missense probably damaging 1.00
R2116:Usp31 UTSW 7 121648696 missense probably benign 0.39
R3113:Usp31 UTSW 7 121679513 missense probably damaging 1.00
R4072:Usp31 UTSW 7 121667782 splice site probably null
R4075:Usp31 UTSW 7 121667782 splice site probably null
R4076:Usp31 UTSW 7 121667782 splice site probably null
R4306:Usp31 UTSW 7 121706929 missense possibly damaging 0.93
R4675:Usp31 UTSW 7 121707325 unclassified probably benign
R4960:Usp31 UTSW 7 121648645 missense probably damaging 0.99
R5368:Usp31 UTSW 7 121661365 missense probably damaging 1.00
R5396:Usp31 UTSW 7 121667782 splice site probably null
R5475:Usp31 UTSW 7 121651526 missense probably damaging 1.00
R5497:Usp31 UTSW 7 121651601 missense probably damaging 1.00
R5872:Usp31 UTSW 7 121649475 missense probably benign 0.05
R6301:Usp31 UTSW 7 121648276 missense possibly damaging 0.76
R6688:Usp31 UTSW 7 121678330 missense probably benign 0.01
R6875:Usp31 UTSW 7 121649640 nonsense probably null
R6895:Usp31 UTSW 7 121653176 missense probably benign 0.00
X0062:Usp31 UTSW 7 121651514 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GTGGCAACTCCTTTCAGAAACTG -3'
(R):5'- GTCCTGAGCAATTCTTTTGACC -3'

Sequencing Primer
(F):5'- AACCGCTGCTTCTGAGTA -3'
(R):5'- CTGAGCAATTCTTTTGACCTTATGG -3'
Posted On2016-10-06