Incidental Mutation 'R5456:Rapgef5'
ID432764
Institutional Source Beutler Lab
Gene Symbol Rapgef5
Ensembl Gene ENSMUSG00000041992
Gene NameRap guanine nucleotide exchange factor (GEF) 5
SynonymsD030051B22Rik, mr-gef
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location117516479-117759737 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 117728646 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109691] [ENSMUST00000222105] [ENSMUST00000222185]
Predicted Effect probably null
Transcript: ENSMUST00000109691
SMART Domains Protein: ENSMUSP00000105313
Gene: ENSMUSG00000041992

DomainStartEndE-ValueType
DEP 44 118 2.07e-12 SMART
RasGEFN 300 434 3.12e-34 SMART
Blast:RasGEF 441 502 7e-31 BLAST
RasGEF 574 814 1.52e-100 SMART
Predicted Effect probably null
Transcript: ENSMUST00000222105
Predicted Effect probably null
Transcript: ENSMUST00000222185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223173
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF5, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Rapgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Rapgef5 APN 12 117714182 missense probably damaging 0.99
IGL01405:Rapgef5 APN 12 117721380 missense probably benign 0.16
IGL01611:Rapgef5 APN 12 117753419 splice site probably benign
IGL01720:Rapgef5 APN 12 117613435 splice site probably benign
IGL01958:Rapgef5 APN 12 117730651 missense probably benign 0.24
IGL02093:Rapgef5 APN 12 117719132 missense probably damaging 0.98
IGL03210:Rapgef5 APN 12 117742872 missense probably damaging 1.00
IGL03370:Rapgef5 APN 12 117730559 missense probably damaging 1.00
IGL03397:Rapgef5 APN 12 117748441 missense probably damaging 1.00
R0026:Rapgef5 UTSW 12 117689161 missense probably benign 0.11
R0026:Rapgef5 UTSW 12 117689161 missense probably benign 0.11
R0100:Rapgef5 UTSW 12 117721299 missense probably benign 0.05
R0173:Rapgef5 UTSW 12 117688676 missense probably benign 0.00
R0834:Rapgef5 UTSW 12 117647121 splice site probably benign
R1331:Rapgef5 UTSW 12 117721349 missense probably benign 0.04
R1505:Rapgef5 UTSW 12 117688619 missense possibly damaging 0.92
R1546:Rapgef5 UTSW 12 117647101 missense probably benign 0.00
R1577:Rapgef5 UTSW 12 117595291 missense probably benign 0.28
R1597:Rapgef5 UTSW 12 117658320 missense probably damaging 1.00
R1824:Rapgef5 UTSW 12 117688684 critical splice donor site probably null
R2065:Rapgef5 UTSW 12 117584119 nonsense probably null
R2117:Rapgef5 UTSW 12 117714064 intron probably null
R2169:Rapgef5 UTSW 12 117715395 missense probably benign 0.25
R2903:Rapgef5 UTSW 12 117714119 missense probably damaging 1.00
R3983:Rapgef5 UTSW 12 117728670 missense possibly damaging 0.49
R4004:Rapgef5 UTSW 12 117748397 missense probably damaging 0.99
R4652:Rapgef5 UTSW 12 117714128 missense probably damaging 0.99
R4830:Rapgef5 UTSW 12 117756074 missense probably damaging 1.00
R5282:Rapgef5 UTSW 12 117739644 missense probably damaging 1.00
R5348:Rapgef5 UTSW 12 117688611 missense probably benign 0.24
R5502:Rapgef5 UTSW 12 117721329 missense probably damaging 1.00
R5741:Rapgef5 UTSW 12 117756029 missense probably damaging 0.99
R5771:Rapgef5 UTSW 12 117721326 missense probably benign 0.45
R5905:Rapgef5 UTSW 12 117748426 missense probably damaging 1.00
R5941:Rapgef5 UTSW 12 117728738 missense probably damaging 1.00
R6228:Rapgef5 UTSW 12 117721663 intron probably null
R6233:Rapgef5 UTSW 12 117739718 critical splice donor site probably null
R6376:Rapgef5 UTSW 12 117721253 missense probably damaging 1.00
R6475:Rapgef5 UTSW 12 117718207 missense probably damaging 1.00
R7063:Rapgef5 UTSW 12 117689129 missense possibly damaging 0.91
X0018:Rapgef5 UTSW 12 117718215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGGGCTGTTTCCTAAATTG -3'
(R):5'- TCCTAGCACAATACACAAGTGTCTC -3'

Sequencing Primer
(F):5'- CCTAAATTGGCTGTAACTCACTG -3'
(R):5'- GCTTACCTCGTGGATTGA -3'
Posted On2016-10-06