Incidental Mutation 'R5457:Hjurp'
ID432782
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene NameHolliday junction recognition protein
Synonyms
MMRRC Submission 043020-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R5457 (G1)
Quality Score217
Status Not validated
Chromosome1
Chromosomal Location88262471-88277633 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) T to TN at 88266525 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
Predicted Effect probably null
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128532
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148384
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C A 8: 86,509,844 V1114L probably benign Het
Actr5 G A 2: 158,635,998 probably null Het
Adcy7 T C 8: 88,311,021 L239P probably damaging Het
Afg3l1 T A 8: 123,489,968 F315L possibly damaging Het
Agps A G 2: 75,854,252 Y188C probably benign Het
Akt1 T C 12: 112,657,091 T312A probably damaging Het
Ang2 T C 14: 51,195,835 Y30C probably damaging Het
Angpt1 G A 15: 42,523,520 T146I probably damaging Het
Atg16l1 T C 1: 87,775,091 S288P probably damaging Het
Atp1b2 C T 11: 69,602,732 G4R probably damaging Het
Best3 T C 10: 117,004,511 F282S probably damaging Het
Cdkn2b A G 4: 89,307,154 L98P probably damaging Het
Cenps A G 4: 149,131,637 probably null Het
Clec16a G T 16: 10,545,532 probably null Het
Cxcl13 A T 5: 95,956,971 M1L unknown Het
Dcun1d4 A T 5: 73,531,565 E149D probably damaging Het
Dlst G A 12: 85,122,140 probably null Het
Dock10 C A 1: 80,524,064 C1803F probably damaging Het
Dpp10 T A 1: 123,411,810 K329N possibly damaging Het
Drosha T G 15: 12,926,029 Y1235D probably benign Het
Eif2s3y G A Y: 1,016,057 G213D probably damaging Homo
Eps8 A T 6: 137,512,177 S408T probably damaging Het
Fam171a2 T C 11: 102,437,536 D799G possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fcrlb T C 1: 170,912,157 T59A probably damaging Het
Fgd4 T C 16: 16,462,009 R395G probably benign Het
Gm14496 A T 2: 181,997,608 D497V probably damaging Het
Gpt2 A C 8: 85,512,338 N267H possibly damaging Het
Grb14 A T 2: 64,917,098 C43S probably damaging Het
Igkv8-16 A G 6: 70,386,705 V111A possibly damaging Het
Klra2 T A 6: 131,221,889 S230C possibly damaging Het
Lamb3 G A 1: 193,325,994 R245H probably damaging Het
Lamc3 A G 2: 31,931,985 E1315G probably benign Het
Lpin2 A G 17: 71,243,372 T672A probably damaging Het
Mcoln3 T A 3: 146,128,122 I139N probably benign Het
Mcpt8 C T 14: 56,082,336 C219Y probably benign Het
Mug2 G T 6: 122,049,729 G541* probably null Het
Myo7b G T 18: 31,971,450 probably null Het
Olfr1406 A G 1: 173,183,613 S274P probably damaging Het
Olfr175-ps1 A T 16: 58,824,433 I92N probably damaging Het
Olfr204 T C 16: 59,314,850 I186V probably benign Het
Olfr418 C T 1: 173,270,574 S133L probably benign Het
Olfr872 A T 9: 20,260,278 Y146F probably damaging Het
Pclo C T 5: 14,676,143 probably benign Het
Pdk2 C T 11: 95,028,582 S289N probably damaging Het
Pex19 G T 1: 172,130,678 G75W probably damaging Het
Psma3 T G 12: 70,984,565 S26A probably benign Het
Pth1r A T 9: 110,726,454 I326N possibly damaging Het
Sbf2 T C 7: 110,312,830 T1670A probably benign Het
Scn10a A G 9: 119,694,127 Y67H probably damaging Het
Sec16a A T 2: 26,440,268 D578E probably benign Het
Soga3 A C 10: 29,196,724 I671L probably benign Het
Spta1 C T 1: 174,217,193 A1465V probably damaging Het
Taar9 A G 10: 24,109,105 F144L probably damaging Het
Tal1 T C 4: 115,068,580 V282A probably benign Het
Tbrg4 C T 11: 6,620,947 R175Q probably damaging Het
Tdp1 C T 12: 99,894,746 Q215* probably null Het
Thsd4 A T 9: 59,979,777 W921R probably damaging Het
Trrap A G 5: 144,849,977 E3462G probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn T C 2: 76,710,921 E25580G probably damaging Het
Ttn A T 2: 76,945,955 I1581N possibly damaging Het
Vmn2r50 T C 7: 10,047,946 T291A probably damaging Het
Zkscan14 T C 5: 145,201,359 D106G probably benign Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88270269 missense probably benign 0.04
IGL03099:Hjurp APN 1 88266289 missense probably benign 0.09
IGL03097:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88266280 utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88266280 utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266046 missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88266278 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266561 utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88266616 missense probably benign 0.04
PIT4378001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R0053:Hjurp UTSW 1 88277215 splice site probably benign
R0371:Hjurp UTSW 1 88277368 splice site probably benign
R0442:Hjurp UTSW 1 88266524 nonsense probably null
R0762:Hjurp UTSW 1 88277215 splice site probably benign
R0928:Hjurp UTSW 1 88266524 nonsense probably null
R1333:Hjurp UTSW 1 88266046 missense probably damaging 0.98
R1342:Hjurp UTSW 1 88277368 splice site probably benign
R1364:Hjurp UTSW 1 88266525 frame shift probably null
R1496:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88266121 missense probably benign 0.03
R1905:Hjurp UTSW 1 88266616 missense probably benign 0.04
R1965:Hjurp UTSW 1 88266524 nonsense probably null
R1992:Hjurp UTSW 1 88266524 nonsense probably null
R2002:Hjurp UTSW 1 88266524 nonsense probably null
R2023:Hjurp UTSW 1 88266524 nonsense probably null
R2024:Hjurp UTSW 1 88266524 nonsense probably null
R2332:Hjurp UTSW 1 88277215 splice site probably benign
R2420:Hjurp UTSW 1 88266524 nonsense probably null
R2422:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R2869:Hjurp UTSW 1 88266524 nonsense probably null
R2870:Hjurp UTSW 1 88266524 nonsense probably null
R2871:Hjurp UTSW 1 88266524 nonsense probably null
R2872:Hjurp UTSW 1 88266524 nonsense probably null
R3019:Hjurp UTSW 1 88266524 nonsense probably null
R3021:Hjurp UTSW 1 88266524 nonsense probably null
R3150:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R3411:Hjurp UTSW 1 88266524 nonsense probably null
R3552:Hjurp UTSW 1 88266524 nonsense probably null
R3704:Hjurp UTSW 1 88277215 splice site probably benign
R3730:Hjurp UTSW 1 88266524 nonsense probably null
R3733:Hjurp UTSW 1 88266524 nonsense probably null
R3764:Hjurp UTSW 1 88266524 nonsense probably null
R3799:Hjurp UTSW 1 88277215 splice site probably benign
R3819:Hjurp UTSW 1 88277215 splice site probably benign
R3857:Hjurp UTSW 1 88266524 nonsense probably null
R3930:Hjurp UTSW 1 88266524 nonsense probably null
R3952:Hjurp UTSW 1 88277215 splice site probably benign
R4090:Hjurp UTSW 1 88277215 splice site probably benign
R4159:Hjurp UTSW 1 88277215 splice site probably benign
R4207:Hjurp UTSW 1 88277215 splice site probably benign
R4322:Hjurp UTSW 1 88277215 splice site probably benign
R4391:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4392:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266524 nonsense probably null
R4393:Hjurp UTSW 1 88266561 utr 3 prime probably benign
R4397:Hjurp UTSW 1 88266524 nonsense probably null
R4700:Hjurp UTSW 1 88266524 nonsense probably null
R4808:Hjurp UTSW 1 88277215 splice site probably benign
R4900:Hjurp UTSW 1 88266524 nonsense probably null
R4901:Hjurp UTSW 1 88266524 nonsense probably null
R5023:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88266524 nonsense probably null
R5123:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88266524 nonsense probably null
R5300:Hjurp UTSW 1 88266524 nonsense probably null
R5318:Hjurp UTSW 1 88266524 nonsense probably null
R5370:Hjurp UTSW 1 88266524 nonsense probably null
R5410:Hjurp UTSW 1 88266524 nonsense probably null
R5445:Hjurp UTSW 1 88266316 missense probably benign 0.43
R5497:Hjurp UTSW 1 88266320 missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88266524 nonsense probably null
R5561:Hjurp UTSW 1 88266524 nonsense probably null
R5615:Hjurp UTSW 1 88266524 nonsense probably null
R5661:Hjurp UTSW 1 88277215 splice site probably benign
R5722:Hjurp UTSW 1 88266524 nonsense probably null
R6087:Hjurp UTSW 1 88266524 nonsense probably null
R6089:Hjurp UTSW 1 88266524 nonsense probably null
R6090:Hjurp UTSW 1 88266524 nonsense probably null
R6125:Hjurp UTSW 1 88266524 nonsense probably null
R6175:Hjurp UTSW 1 88266524 nonsense probably null
R6362:Hjurp UTSW 1 88275050 missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88266524 nonsense probably null
R7016:Hjurp UTSW 1 88266277 utr 3 prime probably benign
R7016:Hjurp UTSW 1 88266278 utr 3 prime probably benign
R7045:Hjurp UTSW 1 88266278 utr 3 prime probably benign
V5622:Hjurp UTSW 1 88277525 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAGCTCTGGTTGATGTAGG -3'
(R):5'- AACTGTCATGGTTTGTGATGCC -3'

Sequencing Primer
(F):5'- AGGTCTTGGTGGAGATGATGCAG -3'
(R):5'- CCTGCCCGGTGGGTAAGTATG -3'
Posted On2016-10-06