Incidental Mutation 'R5457:Dpp10'
ID432783
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Namedipeptidylpeptidase 10
Synonyms6430601K09Rik, DPRP3
MMRRC Submission 043020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5457 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location123321471-124045559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123411810 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 329 (K329N)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
Predicted Effect probably benign
Transcript: ENSMUST00000112603
AA Change: K318N

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: K318N

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112606
AA Change: K329N

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: K329N

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C A 8: 86,509,844 V1114L probably benign Het
Actr5 G A 2: 158,635,998 probably null Het
Adcy7 T C 8: 88,311,021 L239P probably damaging Het
Afg3l1 T A 8: 123,489,968 F315L possibly damaging Het
Agps A G 2: 75,854,252 Y188C probably benign Het
Akt1 T C 12: 112,657,091 T312A probably damaging Het
Ang2 T C 14: 51,195,835 Y30C probably damaging Het
Angpt1 G A 15: 42,523,520 T146I probably damaging Het
Atg16l1 T C 1: 87,775,091 S288P probably damaging Het
Atp1b2 C T 11: 69,602,732 G4R probably damaging Het
Best3 T C 10: 117,004,511 F282S probably damaging Het
Cdkn2b A G 4: 89,307,154 L98P probably damaging Het
Cenps A G 4: 149,131,637 probably null Het
Clec16a G T 16: 10,545,532 probably null Het
Cxcl13 A T 5: 95,956,971 M1L unknown Het
Dcun1d4 A T 5: 73,531,565 E149D probably damaging Het
Dlst G A 12: 85,122,140 probably null Het
Dock10 C A 1: 80,524,064 C1803F probably damaging Het
Drosha T G 15: 12,926,029 Y1235D probably benign Het
Eif2s3y G A Y: 1,016,057 G213D probably damaging Homo
Eps8 A T 6: 137,512,177 S408T probably damaging Het
Fam171a2 T C 11: 102,437,536 D799G possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fcrlb T C 1: 170,912,157 T59A probably damaging Het
Fgd4 T C 16: 16,462,009 R395G probably benign Het
Gm14496 A T 2: 181,997,608 D497V probably damaging Het
Gpt2 A C 8: 85,512,338 N267H possibly damaging Het
Grb14 A T 2: 64,917,098 C43S probably damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Igkv8-16 A G 6: 70,386,705 V111A possibly damaging Het
Klra2 T A 6: 131,221,889 S230C possibly damaging Het
Lamb3 G A 1: 193,325,994 R245H probably damaging Het
Lamc3 A G 2: 31,931,985 E1315G probably benign Het
Lpin2 A G 17: 71,243,372 T672A probably damaging Het
Mcoln3 T A 3: 146,128,122 I139N probably benign Het
Mcpt8 C T 14: 56,082,336 C219Y probably benign Het
Mug2 G T 6: 122,049,729 G541* probably null Het
Myo7b G T 18: 31,971,450 probably null Het
Olfr1406 A G 1: 173,183,613 S274P probably damaging Het
Olfr175-ps1 A T 16: 58,824,433 I92N probably damaging Het
Olfr204 T C 16: 59,314,850 I186V probably benign Het
Olfr418 C T 1: 173,270,574 S133L probably benign Het
Olfr872 A T 9: 20,260,278 Y146F probably damaging Het
Pclo C T 5: 14,676,143 probably benign Het
Pdk2 C T 11: 95,028,582 S289N probably damaging Het
Pex19 G T 1: 172,130,678 G75W probably damaging Het
Psma3 T G 12: 70,984,565 S26A probably benign Het
Pth1r A T 9: 110,726,454 I326N possibly damaging Het
Sbf2 T C 7: 110,312,830 T1670A probably benign Het
Scn10a A G 9: 119,694,127 Y67H probably damaging Het
Sec16a A T 2: 26,440,268 D578E probably benign Het
Soga3 A C 10: 29,196,724 I671L probably benign Het
Spta1 C T 1: 174,217,193 A1465V probably damaging Het
Taar9 A G 10: 24,109,105 F144L probably damaging Het
Tal1 T C 4: 115,068,580 V282A probably benign Het
Tbrg4 C T 11: 6,620,947 R175Q probably damaging Het
Tdp1 C T 12: 99,894,746 Q215* probably null Het
Thsd4 A T 9: 59,979,777 W921R probably damaging Het
Trrap A G 5: 144,849,977 E3462G probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn T C 2: 76,710,921 E25580G probably damaging Het
Ttn A T 2: 76,945,955 I1581N possibly damaging Het
Vmn2r50 T C 7: 10,047,946 T291A probably damaging Het
Zkscan14 T C 5: 145,201,359 D106G probably benign Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123905125 missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2079:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3876:Dpp10 UTSW 1 123353487 missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123367601 missense possibly damaging 0.72
R6505:Dpp10 UTSW 1 123336851 missense probably damaging 0.99
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6894:Dpp10 UTSW 1 123336864 missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAAACCTGACTTCCAAAGC -3'
(R):5'- GAAAAGTCAAGTGTAGGCTAGTTTC -3'

Sequencing Primer
(F):5'- GCAATGACTCCTAACCATTTTACC -3'
(R):5'- TCTGGTAAATAATTCATTCTCAC -3'
Posted On2016-10-06