Incidental Mutation 'R5458:Fggy'
ID432863
Institutional Source Beutler Lab
Gene Symbol Fggy
Ensembl Gene ENSMUSG00000028573
Gene NameFGGY carbohydrate kinase domain containing
Synonyms2310009E04Rik
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location95557507-95926939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95926743 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 445 (Q445R)
Ref Sequence ENSEMBL: ENSMUSP00000102706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079223] [ENSMUST00000107091] [ENSMUST00000130541]
Predicted Effect probably benign
Transcript: ENSMUST00000079223
AA Change: Q533R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078216
Gene: ENSMUSG00000028573
AA Change: Q533R

DomainStartEndE-ValueType
Pfam:FGGY_N 12 268 3.3e-27 PFAM
Pfam:FGGY_C 290 498 1.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107091
AA Change: Q445R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102706
Gene: ENSMUSG00000028573
AA Change: Q445R

DomainStartEndE-ValueType
Pfam:FGGY_N 12 78 1.7e-10 PFAM
Pfam:FGGY_C 202 410 1.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130541
SMART Domains Protein: ENSMUSP00000115688
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
Pfam:FGGY_C 1 150 3.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141248
Predicted Effect probably benign
Transcript: ENSMUST00000142384
Predicted Effect probably benign
Transcript: ENSMUST00000156223
SMART Domains Protein: ENSMUSP00000118147
Gene: ENSMUSG00000028573

DomainStartEndE-ValueType
Pfam:FGGY_C 6 124 8.5e-26 PFAM
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that phosphorylates carbohydrates such as ribulose, ribitol, and L-arabinitol. Genome-wide association studies in some populations have found an association between polymorphisms in this gene and sporadic amyotrophic lateral sclerosis, but studies of other populations have not been able to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Fggy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Fggy APN 4 95837628 missense possibly damaging 0.86
IGL02377:Fggy APN 4 95623477 unclassified probably benign
IGL02417:Fggy APN 4 95849609 missense probably benign 0.01
IGL02527:Fggy APN 4 95697069 missense probably damaging 1.00
IGL02967:Fggy APN 4 95926749 missense possibly damaging 0.74
IGL03053:Fggy APN 4 95926809 unclassified probably benign
IGL03168:Fggy APN 4 95926809 unclassified probably benign
IGL03370:Fggy APN 4 95822064 missense probably damaging 1.00
R0164:Fggy UTSW 4 95837654 missense probably damaging 0.97
R0164:Fggy UTSW 4 95837654 missense probably damaging 0.97
R0312:Fggy UTSW 4 95844185 missense probably damaging 1.00
R0520:Fggy UTSW 4 95601103 missense probably damaging 1.00
R0747:Fggy UTSW 4 95812100 splice site probably benign
R0940:Fggy UTSW 4 95697001 missense probably benign 0.40
R1513:Fggy UTSW 4 95902058 intron probably benign
R1746:Fggy UTSW 4 95926728 missense probably damaging 1.00
R2998:Fggy UTSW 4 95849585 missense probably benign 0.01
R3848:Fggy UTSW 4 95601124 unclassified probably benign
R4913:Fggy UTSW 4 95697076 critical splice donor site probably null
R5868:Fggy UTSW 4 95696988 missense probably damaging 0.99
R6583:Fggy UTSW 4 95600973 missense probably benign 0.01
R6589:Fggy UTSW 4 95597638 missense probably benign 0.00
R7332:Fggy UTSW 4 95623482 missense probably damaging 0.98
R7359:Fggy UTSW 4 95769480 missense probably benign 0.40
R7453:Fggy UTSW 4 95597690 missense probably damaging 1.00
X0067:Fggy UTSW 4 95696992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGCACCTTGCTGATAAAAC -3'
(R):5'- ACTCCAGTTGTGTTTGCCTG -3'

Sequencing Primer
(F):5'- ATGTCAAGCATGCATCTTGC -3'
(R):5'- TGCCTGCTCGAAGTTTTTATTAG -3'
Posted On2016-10-06