Incidental Mutation 'R5458:Scmh1'
ID432865
Institutional Source Beutler Lab
Gene Symbol Scmh1
Ensembl Gene ENSMUSG00000000085
Gene Namesex comb on midleg homolog 1
SynonymsScml3
MMRRC Submission 043021-MU
Accession Numbers

Ncbi RefSeq: NM_013883.2, NM_001159630.1; MGI:1352762

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location120405281-120530186 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 120505281 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000000087] [ENSMUST00000064991] [ENSMUST00000106298] [ENSMUST00000106301]
Predicted Effect probably benign
Transcript: ENSMUST00000000087
SMART Domains Protein: ENSMUSP00000000087
Gene: ENSMUSG00000000085

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 354 468 4.3e-50 PFAM
SAM 594 662 1.8e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064991
SMART Domains Protein: ENSMUSP00000069813
Gene: ENSMUSG00000000085

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 357 465 5.8e-39 PFAM
SAM 594 662 1.57e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106298
SMART Domains Protein: ENSMUSP00000101905
Gene: ENSMUSG00000000085

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 354 468 4.3e-50 PFAM
SAM 594 662 1.8e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106301
SMART Domains Protein: ENSMUSP00000101908
Gene: ENSMUSG00000000085

DomainStartEndE-ValueType
MBT 28 126 2.47e-48 SMART
MBT 134 235 1.36e-45 SMART
low complexity region 268 285 N/A INTRINSIC
low complexity region 301 340 N/A INTRINSIC
Pfam:DUF3588 354 468 4.7e-50 PFAM
SAM 594 662 1.57e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122860
SMART Domains Protein: ENSMUSP00000120950
Gene: ENSMUSG00000000085

DomainStartEndE-ValueType
Pfam:DUF3588 60 120 4.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144555
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype Strain: 3706668
PHENOTYPE: Mice homozygous for an allele lacking the SPM domain exhibit partial penetrance of posterior vertebral transformations and male infertility with azoospermia and arrest of spermatogenesis. Mice homozygous for a knock-out allele exhibit abnormal hematopoiesis but normal fertility and skeleton. [provided by MGI curators]
Allele List at MGI

All alleles(67) : Targeted(4) Gene trapped(63)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Scmh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Scmh1 APN 4 120529900 utr 3 prime probably benign
IGL01962:Scmh1 APN 4 120483584 splice site probably benign
IGL02013:Scmh1 APN 4 120483732 missense possibly damaging 0.77
IGL02081:Scmh1 APN 4 120515078 missense probably damaging 1.00
IGL02223:Scmh1 APN 4 120515219 missense probably benign 0.26
IGL02530:Scmh1 APN 4 120528146 splice site probably benign
IGL02887:Scmh1 APN 4 120468389 missense probably damaging 1.00
P0024:Scmh1 UTSW 4 120478034 missense probably damaging 1.00
R0164:Scmh1 UTSW 4 120529865 unclassified probably benign
R0164:Scmh1 UTSW 4 120529865 unclassified probably benign
R0200:Scmh1 UTSW 4 120483831 missense probably damaging 0.99
R1598:Scmh1 UTSW 4 120515130 missense possibly damaging 0.83
R1624:Scmh1 UTSW 4 120529228 missense probably damaging 1.00
R2276:Scmh1 UTSW 4 120483672 missense probably damaging 1.00
R3734:Scmh1 UTSW 4 120478080 missense probably damaging 1.00
R4167:Scmh1 UTSW 4 120529276 intron probably benign
R4570:Scmh1 UTSW 4 120528298 missense probably damaging 1.00
R5564:Scmh1 UTSW 4 120468378 missense probably damaging 1.00
R5700:Scmh1 UTSW 4 120516946 missense probably benign 0.10
R5991:Scmh1 UTSW 4 120522620 missense probably benign
R5999:Scmh1 UTSW 4 120505515 critical splice donor site probably null
R7097:Scmh1 UTSW 4 120525055 missense probably benign
R7432:Scmh1 UTSW 4 120529156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCCAGTTCTGAGCCTCTGG -3'
(R):5'- AAGGTTCAGCTGACTTGGATGG -3'

Sequencing Primer
(F):5'- AGCCCATTTGAGTGGCATC -3'
(R):5'- CAGCTGACTTGGATGGGGTAGAG -3'
Posted On2016-10-06