Incidental Mutation 'R5458:Fv1'
ID432866
Institutional Source Beutler Lab
Gene Symbol Fv1
Ensembl Gene ENSMUSG00000070583
Gene NameFriend virus susceptibility 1
SynonymsRv1, Rv-1, Fv-1
MMRRC Submission 043021-MU
Accession Numbers

Genbank: NM_010244

Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location147868979-147870358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 147870269 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 431 (S431G)
Ref Sequence ENSEMBL: ENSMUSP00000092054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030884] [ENSMUST00000030886] [ENSMUST00000094481] [ENSMUST00000105715] [ENSMUST00000105716] [ENSMUST00000119975] [ENSMUST00000172710]
Predicted Effect probably benign
Transcript: ENSMUST00000030884
SMART Domains Protein: ENSMUSP00000030884
Gene: ENSMUSG00000029020

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 3.8e-6 PFAM
Pfam:Dynamin_N 99 259 2e-24 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 594 754 1.6e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030886
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094481
AA Change: S431G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000092054
Gene: ENSMUSG00000070583
AA Change: S431G

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
coiled coil region 86 116 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105715
SMART Domains Protein: ENSMUSP00000101340
Gene: ENSMUSG00000029020

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 9e-7 PFAM
Pfam:Dynamin_N 99 259 5.4e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 586 756 3.9e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105716
SMART Domains Protein: ENSMUSP00000101341
Gene: ENSMUSG00000029020

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 9e-7 PFAM
Pfam:Dynamin_N 99 259 5.4e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 586 756 3.9e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119975
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156374
Predicted Effect probably benign
Transcript: ENSMUST00000172710
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174081
Meta Mutation Damage Score 0.1644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: NIH Swiss, AKR and C57L are N-tropic virus susceptible and B-tropic resistant (n allele); BALB/c, A and C57BL/6 show opposite susceptibility (b allele); RF, 129, NZB and NZW have increased N-tropic resistance (nr allele); M.m. praetextus and M. spretus are susceptible to N- and B- types (o allele). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Fv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01417:Fv1 APN 4 147869329 nonsense probably null
IGL01998:Fv1 APN 4 147869327 missense possibly damaging 0.83
IGL02192:Fv1 APN 4 147870255 missense possibly damaging 0.90
G5030:Fv1 UTSW 4 147869161 missense possibly damaging 0.82
R1501:Fv1 UTSW 4 147870138 missense probably damaging 0.97
R1912:Fv1 UTSW 4 147869778 missense possibly damaging 0.66
R1992:Fv1 UTSW 4 147869161 missense possibly damaging 0.82
R2110:Fv1 UTSW 4 147870162 missense possibly damaging 0.46
R4911:Fv1 UTSW 4 147869418 missense probably benign 0.00
R5350:Fv1 UTSW 4 147870089 missense possibly damaging 0.46
R6271:Fv1 UTSW 4 147870017 missense possibly damaging 0.66
R6314:Fv1 UTSW 4 147869699 unclassified probably null
R6988:Fv1 UTSW 4 147869271 missense possibly damaging 0.66
R7055:Fv1 UTSW 4 147870318 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGCTACTTGTCCACAGTGGA -3'
(R):5'- CAGCTAGCTGCCTGTAGTGC -3'

Sequencing Primer
(F):5'- AGGGGCCCGGAAGATGTAC -3'
(R):5'- ATGTTTCCAGGGAGAGAG -3'
Posted On2016-10-06