Incidental Mutation 'R0479:Tecta'
ID43287
Institutional Source Beutler Lab
Gene Symbol Tecta
Ensembl Gene ENSMUSG00000037705
Gene Nametectorin alpha
Synonyms[a]-tectorin, Tctna
MMRRC Submission 038679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R0479 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location42329619-42399929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42337939 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1871 (I1871F)
Ref Sequence ENSEMBL: ENSMUSP00000125370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042190] [ENSMUST00000160940]
Predicted Effect probably damaging
Transcript: ENSMUST00000042190
AA Change: I1876F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040262
Gene: ENSMUSG00000037705
AA Change: I1876F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 9.8e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1684 1758 6.51e-10 SMART
ZP 1805 2059 2.95e-85 SMART
EGF 2087 2122 2.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159603
Predicted Effect probably damaging
Transcript: ENSMUST00000160940
AA Change: I1871F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125370
Gene: ENSMUSG00000037705
AA Change: I1871F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
NIDO 98 254 7.88e-77 SMART
VWC 260 314 1.04e0 SMART
VWD 312 477 1.5e-58 SMART
C8 517 592 7.06e-29 SMART
EGF_like 622 645 3.87e1 SMART
VWC 652 713 1.87e-1 SMART
VWD 703 865 4.44e-43 SMART
C8 905 981 9.19e-19 SMART
Pfam:TIL 984 1036 6.1e-13 PFAM
VWD 1090 1257 1.44e-51 SMART
C8 1294 1369 4.64e-15 SMART
EGF_like 1388 1420 5.34e1 SMART
VWC 1427 1487 2.88e-19 SMART
VWD 1477 1638 2.72e-38 SMART
C8 1679 1753 6.51e-10 SMART
ZP 1800 2054 2.95e-85 SMART
EGF 2082 2117 2.07e1 SMART
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The tectorial membrane is an extracellular matrix of the inner ear that contacts the stereocilia bundles of specialized sensory hair cells. Sound induces movement of these hair cells relative to the tectorial membrane, deflects the stereocilia, and leads to fluctuations in hair-cell membrane potential, transducing sound into electrical signals. Alpha-tectorin is one of the major noncollagenous components of the tectorial membrane. Mutations in the TECTA gene have been shown to be responsible for autosomal dominant nonsyndromic hearing impairment and a recessive form of sensorineural pre-lingual non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a tectorial membrane that is detached from the cochlear epithelium. Though the basilar membranes of mutant mice are tuned, sensitivity is attenuated. Mice with an Y1870C mutation have a disrupted tectorial membrane, elevated neural thresholds and broadened neural tuning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,145 V269A probably benign Het
Acsl1 G A 8: 46,531,072 G543R probably damaging Het
Adam18 T C 8: 24,651,822 N244D probably benign Het
Adgra3 C T 5: 49,990,265 V478M probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Arhgef10 A T 8: 14,991,070 E723V probably damaging Het
Arid3a C A 10: 79,951,294 N519K possibly damaging Het
Atrn T A 2: 130,999,165 Y1162* probably null Het
Cacng5 T A 11: 107,877,951 N172Y probably benign Het
Cct8 C T 16: 87,487,706 V198M probably damaging Het
Cep192 G A 18: 67,858,018 S1857N probably damaging Het
Cherp A T 8: 72,463,147 D657E possibly damaging Het
Clca2 T G 3: 145,090,849 D199A probably damaging Het
Cops7b A G 1: 86,605,076 T219A probably benign Het
Crb1 C T 1: 139,198,614 M1392I probably damaging Het
Csf3r A C 4: 126,043,823 E833D probably damaging Het
Cutc A G 19: 43,768,216 E247G probably damaging Het
Cyp2c38 A G 19: 39,463,005 L17P probably damaging Het
D430042O09Rik T C 7: 125,843,346 L809S probably benign Het
D5Ertd615e T A 5: 45,163,454 noncoding transcript Het
Ddx60 G T 8: 61,969,657 G643W probably damaging Het
Depdc1a C T 3: 159,520,860 T268I probably damaging Het
Dgke T C 11: 89,052,470 E231G probably benign Het
Dhrs7b T A 11: 60,855,687 probably benign Het
Dll3 A G 7: 28,301,549 V27A probably damaging Het
Dnmt3c T A 2: 153,714,941 probably null Het
Duox1 T C 2: 122,346,380 F1461L probably damaging Het
Enpep A G 3: 129,312,674 V301A possibly damaging Het
Eny2 T A 15: 44,435,604 probably null Het
Esr1 A G 10: 4,997,911 D488G probably damaging Het
Ets1 A G 9: 32,730,180 K110E probably damaging Het
Eya2 T A 2: 165,715,956 Y157* probably null Het
F830045P16Rik T G 2: 129,472,688 D223A possibly damaging Het
Fbxo18 A G 2: 11,758,419 Y475H probably damaging Het
Fbxo39 T C 11: 72,317,593 I257T probably damaging Het
Fkbp10 T C 11: 100,415,914 V23A probably damaging Het
Foxp3 A G X: 7,587,344 I128V possibly damaging Het
Fzd7 T C 1: 59,483,708 F250S probably damaging Het
Gaa A G 11: 119,281,236 T722A possibly damaging Het
Gemin5 A G 11: 58,139,551 V816A probably benign Het
Glb1l3 T A 9: 26,829,093 T314S probably benign Het
H2-Ab1 A G 17: 34,264,968 E101G possibly damaging Het
Hydin A C 8: 110,599,088 T4710P probably damaging Het
Ica1 C T 6: 8,754,627 V48M probably damaging Het
Ica1 T C 6: 8,754,683 Y29C probably damaging Het
Ints7 T A 1: 191,614,554 probably null Het
Iqub T C 6: 24,505,810 E33G probably benign Het
Itgb1bp2 T A X: 101,449,200 C10S probably damaging Het
Kcnd1 T A X: 7,831,222 I391N possibly damaging Het
Kdm8 T C 7: 125,452,640 L135P probably damaging Het
Ksr1 T C 11: 79,025,283 D574G probably damaging Het
Lama5 C T 2: 180,184,457 R2331H probably benign Het
Larp1 C A 11: 58,042,820 N357K possibly damaging Het
Lgi3 C T 14: 70,534,552 probably benign Het
Lmbrd1 T A 1: 24,746,797 probably benign Het
Methig1 A T 15: 100,374,944 K53* probably null Het
Mfap3 T A 11: 57,529,643 I150N probably damaging Het
Mug1 A T 6: 121,840,227 Q85L probably benign Het
Npl A G 1: 153,515,409 V200A probably damaging Het
Nuf2 A T 1: 169,498,934 probably benign Het
Obscn A G 11: 59,112,707 V1255A probably damaging Het
Olfr186 C T 16: 59,027,128 V260M possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr916 T C 9: 38,658,182 D70G probably damaging Het
P2rx1 T C 11: 73,012,961 V283A probably damaging Het
Pex2 C A 3: 5,561,295 L151F probably damaging Het
Pias1 A G 9: 62,893,118 probably benign Het
Pmfbp1 A T 8: 109,530,473 probably benign Het
Pogz A G 3: 94,876,636 K545E possibly damaging Het
Ppp3cb T C 14: 20,503,241 probably null Het
Prl G A 13: 27,064,928 D189N probably damaging Het
Prpf6 A G 2: 181,651,127 N794S probably benign Het
Prr36 G A 8: 4,213,930 Q579* probably null Het
Ptprq A T 10: 107,643,994 Y1138* probably null Het
Rabepk A T 2: 34,785,580 H179Q probably damaging Het
Rest T C 5: 77,282,751 S1006P probably damaging Het
Rimklb A C 6: 122,464,216 probably benign Het
Rnpepl1 T C 1: 92,918,865 probably benign Het
Sacs T A 14: 61,191,479 L329Q probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Setd5 A T 6: 113,115,033 I272F probably damaging Het
Sgk1 G T 10: 21,996,310 A262S probably benign Het
Skint2 G A 4: 112,624,041 V34I possibly damaging Het
Skint5 G C 4: 113,655,672 Q888E unknown Het
Slc4a3 T C 1: 75,551,828 probably benign Het
Sox10 T C 15: 79,163,319 E133G probably damaging Het
Spryd3 G A 15: 102,130,400 R129* probably null Het
Stag1 T A 9: 100,928,091 N782K probably benign Het
Stam T C 2: 14,117,495 L132P probably damaging Het
Stard9 T A 2: 120,697,596 S1445T probably damaging Het
Syt5 C T 7: 4,543,109 R94Q probably benign Het
Tbc1d23 A T 16: 57,171,814 H594Q probably damaging Het
Tek A G 4: 94,804,312 D219G probably benign Het
Thrb T C 14: 18,033,643 F469L probably damaging Het
Trove2 A T 1: 143,757,751 D536E possibly damaging Het
Tyr T C 7: 87,493,221 S44G possibly damaging Het
Usp20 T A 2: 31,017,475 V673E probably benign Het
Usp28 T C 9: 49,037,213 S873P probably damaging Het
Usp43 C T 11: 67,897,274 V306M possibly damaging Het
Wdr17 G T 8: 54,651,421 probably null Het
Wsb2 T G 5: 117,376,679 probably benign Het
Xkrx A T X: 134,150,966 L312Q probably damaging Het
Other mutations in Tecta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Tecta APN 9 42332548 missense probably damaging 1.00
IGL00925:Tecta APN 9 42375035 missense probably benign
IGL00960:Tecta APN 9 42359080 missense possibly damaging 0.74
IGL00974:Tecta APN 9 42331374 missense probably benign 0.00
IGL01070:Tecta APN 9 42395003 missense probably damaging 1.00
IGL01284:Tecta APN 9 42345620 missense probably damaging 1.00
IGL01324:Tecta APN 9 42345431 missense probably damaging 1.00
IGL01694:Tecta APN 9 42367179 missense possibly damaging 0.92
IGL01861:Tecta APN 9 42373362 missense probably benign
IGL02010:Tecta APN 9 42337193 missense probably damaging 0.97
IGL02397:Tecta APN 9 42394998 missense probably damaging 1.00
IGL03031:Tecta APN 9 42345493 missense probably benign
IGL03208:Tecta APN 9 42337100 splice site probably benign
IGL03249:Tecta APN 9 42391886 missense probably benign 0.20
R0004:Tecta UTSW 9 42345478 missense possibly damaging 0.74
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0045:Tecta UTSW 9 42375191 missense probably damaging 1.00
R0119:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0133:Tecta UTSW 9 42367228 missense probably benign 0.00
R0157:Tecta UTSW 9 42375011 missense probably benign
R0180:Tecta UTSW 9 42366813 missense probably benign
R0299:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0345:Tecta UTSW 9 42384218 missense probably damaging 0.98
R0370:Tecta UTSW 9 42366804 missense probably benign
R0465:Tecta UTSW 9 42359418 missense possibly damaging 0.62
R0466:Tecta UTSW 9 42373073 missense probably benign
R0498:Tecta UTSW 9 42377614 missense probably damaging 1.00
R0499:Tecta UTSW 9 42352063 missense probably damaging 1.00
R0519:Tecta UTSW 9 42347892 splice site probably benign
R0584:Tecta UTSW 9 42347908 missense possibly damaging 0.79
R0589:Tecta UTSW 9 42345634 missense probably benign 0.01
R0607:Tecta UTSW 9 42388205 missense probably damaging 1.00
R0691:Tecta UTSW 9 42384341 missense probably damaging 1.00
R0905:Tecta UTSW 9 42338994 missense probably damaging 1.00
R1216:Tecta UTSW 9 42377907 missense probably benign 0.44
R1239:Tecta UTSW 9 42332485 missense probably damaging 1.00
R1442:Tecta UTSW 9 42332482 missense probably damaging 1.00
R1553:Tecta UTSW 9 42348186 missense probably damaging 1.00
R1727:Tecta UTSW 9 42359301 missense probably damaging 0.96
R1728:Tecta UTSW 9 42391922 missense probably benign 0.12
R1729:Tecta UTSW 9 42391922 missense probably benign 0.12
R1762:Tecta UTSW 9 42375309 missense probably benign 0.30
R1778:Tecta UTSW 9 42343631 missense probably damaging 1.00
R1795:Tecta UTSW 9 42378049 missense probably benign
R1796:Tecta UTSW 9 42384197 missense probably damaging 1.00
R1866:Tecta UTSW 9 42392024 missense probably damaging 0.97
R1871:Tecta UTSW 9 42337176 missense probably damaging 0.98
R1871:Tecta UTSW 9 42337340 missense probably damaging 1.00
R1911:Tecta UTSW 9 42337936 missense probably damaging 1.00
R2074:Tecta UTSW 9 42337279 nonsense probably null
R2135:Tecta UTSW 9 42340285 missense probably damaging 1.00
R2171:Tecta UTSW 9 42358924 missense probably damaging 0.99
R2220:Tecta UTSW 9 42392030 missense probably damaging 1.00
R2372:Tecta UTSW 9 42388274 missense probably damaging 1.00
R2570:Tecta UTSW 9 42332552 missense probably damaging 1.00
R2939:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R2940:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3081:Tecta UTSW 9 42377994 missense possibly damaging 0.63
R3407:Tecta UTSW 9 42337854 missense probably damaging 1.00
R3732:Tecta UTSW 9 42392106 missense possibly damaging 0.95
R3771:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3772:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3773:Tecta UTSW 9 42330996 missense probably damaging 1.00
R3832:Tecta UTSW 9 42339033 missense probably damaging 1.00
R4378:Tecta UTSW 9 42366708 missense probably damaging 1.00
R4480:Tecta UTSW 9 42373233 missense possibly damaging 0.75
R4485:Tecta UTSW 9 42337274 missense possibly damaging 0.73
R4804:Tecta UTSW 9 42398237 missense probably benign
R4869:Tecta UTSW 9 42375534 missense probably benign 0.02
R4944:Tecta UTSW 9 42330277 missense probably benign 0.05
R5008:Tecta UTSW 9 42373062 missense possibly damaging 0.76
R5014:Tecta UTSW 9 42373242 missense probably damaging 1.00
R5125:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5178:Tecta UTSW 9 42375185 missense probably damaging 1.00
R5180:Tecta UTSW 9 42337208 missense probably damaging 1.00
R5214:Tecta UTSW 9 42345668 missense probably benign 0.04
R5230:Tecta UTSW 9 42394943 missense probably damaging 0.96
R5330:Tecta UTSW 9 42337856 missense probably damaging 1.00
R5387:Tecta UTSW 9 42375063 missense probably damaging 0.98
R5614:Tecta UTSW 9 42339055 missense probably damaging 1.00
R5708:Tecta UTSW 9 42338926 missense probably damaging 1.00
R5738:Tecta UTSW 9 42373178 missense possibly damaging 0.63
R5770:Tecta UTSW 9 42345589 missense possibly damaging 0.94
R5839:Tecta UTSW 9 42331023 missense probably benign 0.03
R5839:Tecta UTSW 9 42372976 missense possibly damaging 0.86
R6119:Tecta UTSW 9 42373075 missense probably benign 0.00
R6246:Tecta UTSW 9 42377908 missense probably benign 0.07
R6377:Tecta UTSW 9 42343755 missense probably damaging 1.00
R6416:Tecta UTSW 9 42375267 missense probably damaging 0.97
R6595:Tecta UTSW 9 42384227 missense probably damaging 1.00
R6850:Tecta UTSW 9 42343838 missense probably benign 0.20
R6859:Tecta UTSW 9 42392129 missense probably damaging 1.00
R6861:Tecta UTSW 9 42337337 missense possibly damaging 0.93
R6939:Tecta UTSW 9 42347997 missense probably damaging 1.00
R6996:Tecta UTSW 9 42366786 missense probably benign
R7069:Tecta UTSW 9 42394941 missense probably benign 0.03
R7104:Tecta UTSW 9 42366943 missense probably benign 0.00
R7129:Tecta UTSW 9 42347991 missense probably damaging 1.00
R7220:Tecta UTSW 9 42343887 missense probably benign 0.05
R7251:Tecta UTSW 9 42387752 missense probably damaging 1.00
R7307:Tecta UTSW 9 42377992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAGCCCCTGAAAGTCTTTACC -3'
(R):5'- ATTCAGTGGTCCACGGAATCTGCC -3'

Sequencing Primer
(F):5'- CTTAGCATAGGCTTCACGACAG -3'
(R):5'- TATCATCTGAAGGGCACTGC -3'
Posted On2013-05-23