Incidental Mutation 'R5458:Lipc'
ID432883
Institutional Source Beutler Lab
Gene Symbol Lipc
Ensembl Gene ENSMUSG00000032207
Gene Namelipase, hepatic
SynonymsHpl, HL
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70798128-70952226 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 70852582 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034731] [ENSMUST00000214995] [ENSMUST00000216798]
Predicted Effect probably benign
Transcript: ENSMUST00000034731
SMART Domains Protein: ENSMUSP00000034731
Gene: ENSMUSG00000032207

DomainStartEndE-ValueType
Pfam:Lipase 14 350 1.1e-136 PFAM
LH2 353 488 4.62e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179930
Predicted Effect probably benign
Transcript: ENSMUST00000214995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215814
Predicted Effect probably benign
Transcript: ENSMUST00000216798
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIPC encodes hepatic triglyceride lipase, which is expressed in liver. LIPC has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit elevated plasma total cholesterol, phospholipids, and high density lipoprotein cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Lipc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lipc APN 9 70820437 missense possibly damaging 0.56
IGL02431:Lipc APN 9 70934468 intron probably benign
Immunobolic UTSW 9 70823386 missense probably damaging 1.00
R0112:Lipc UTSW 9 70820427 missense probably damaging 1.00
R0114:Lipc UTSW 9 70803781 missense probably damaging 0.99
R0545:Lipc UTSW 9 70812705 missense probably damaging 1.00
R1051:Lipc UTSW 9 70802116 missense probably benign 0.00
R1069:Lipc UTSW 9 70823537 missense probably benign 0.03
R1350:Lipc UTSW 9 70798367 missense probably benign 0.00
R1742:Lipc UTSW 9 70820529 missense probably damaging 1.00
R2145:Lipc UTSW 9 70934535 missense possibly damaging 0.94
R3880:Lipc UTSW 9 70820518 missense probably damaging 0.99
R4360:Lipc UTSW 9 70852582 intron probably benign
R4999:Lipc UTSW 9 70816731 missense probably benign 0.00
R5159:Lipc UTSW 9 70812910 missense probably benign 0.03
R5197:Lipc UTSW 9 70798391 missense probably benign 0.11
R5710:Lipc UTSW 9 70812697 missense probably benign 0.30
R6645:Lipc UTSW 9 70803748 missense probably damaging 1.00
R6749:Lipc UTSW 9 70823386 missense probably damaging 1.00
R6849:Lipc UTSW 9 70818847 critical splice donor site probably null
R7011:Lipc UTSW 9 70818954 missense probably benign 0.09
R7346:Lipc UTSW 9 70812747 missense probably damaging 1.00
R7426:Lipc UTSW 9 70802168 missense probably benign 0.21
X0054:Lipc UTSW 9 70812748 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCATTCACTTGCTGCAGG -3'
(R):5'- TCTTGATGGTGCCGCAACAG -3'

Sequencing Primer
(F):5'- CATTCACTTGCTGCAGGTCATGAG -3'
(R):5'- AGGCTCTCCTGTGTGCAGTAC -3'
Posted On2016-10-06