Incidental Mutation 'R5458:Trappc12'
ID432893
Institutional Source Beutler Lab
Gene Symbol Trappc12
Ensembl Gene ENSMUSG00000020628
Gene Nametrafficking protein particle complex 12
SynonymsTtc15, D930014A20Rik, CGI-87
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location28690628-28750472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28746390 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 381 (V381A)
Ref Sequence ENSEMBL: ENSMUSP00000132009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020954] [ENSMUST00000168129] [ENSMUST00000170994]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020954
AA Change: V381A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020954
Gene: ENSMUSG00000020628
AA Change: V381A

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
TPR 607 640 3.67e-3 SMART
TPR 642 675 1.44e1 SMART
TPR 682 715 3.37e-2 SMART
TPR 716 749 2.99e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168129
AA Change: V381A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127752
Gene: ENSMUSG00000020628
AA Change: V381A

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
TPR 607 640 3.67e-3 SMART
TPR 642 675 1.44e1 SMART
TPR 682 715 3.37e-2 SMART
TPR 716 749 2.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170994
AA Change: V381A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132009
Gene: ENSMUSG00000020628
AA Change: V381A

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223552
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Trappc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Trappc12 APN 12 28737836 missense probably damaging 0.99
IGL01018:Trappc12 APN 12 28691854 splice site probably benign
IGL01295:Trappc12 APN 12 28746762 missense probably damaging 1.00
IGL01365:Trappc12 APN 12 28747402 missense probably damaging 1.00
IGL01490:Trappc12 APN 12 28746915 missense probably damaging 1.00
IGL01975:Trappc12 APN 12 28692492 critical splice donor site probably null
IGL02851:Trappc12 APN 12 28691406 missense probably damaging 0.98
IGL02885:Trappc12 APN 12 28747014 missense probably benign
IGL03163:Trappc12 APN 12 28746654 missense probably damaging 1.00
R0102:Trappc12 UTSW 12 28746752 missense probably damaging 1.00
R0102:Trappc12 UTSW 12 28746752 missense probably damaging 1.00
R0330:Trappc12 UTSW 12 28747260 missense probably benign 0.00
R0517:Trappc12 UTSW 12 28697134 splice site probably benign
R0837:Trappc12 UTSW 12 28703597 missense possibly damaging 0.92
R1439:Trappc12 UTSW 12 28747161 missense possibly damaging 0.96
R1477:Trappc12 UTSW 12 28737752 missense probably benign 0.25
R1651:Trappc12 UTSW 12 28691777 missense probably benign 0.32
R1899:Trappc12 UTSW 12 28746985 missense probably damaging 0.97
R1900:Trappc12 UTSW 12 28746985 missense probably damaging 0.97
R2133:Trappc12 UTSW 12 28746598 missense probably benign 0.00
R2174:Trappc12 UTSW 12 28747381 missense possibly damaging 0.94
R4449:Trappc12 UTSW 12 28747235 missense probably benign 0.05
R5031:Trappc12 UTSW 12 28692513 missense possibly damaging 0.86
R5209:Trappc12 UTSW 12 28737794 missense probably benign 0.03
R5220:Trappc12 UTSW 12 28746697 missense probably damaging 0.97
R5471:Trappc12 UTSW 12 28691500 missense probably damaging 1.00
R5482:Trappc12 UTSW 12 28691325 missense probably damaging 0.97
R5808:Trappc12 UTSW 12 28746864 missense probably damaging 1.00
R5916:Trappc12 UTSW 12 28691514 missense probably damaging 1.00
R5996:Trappc12 UTSW 12 28747114 missense possibly damaging 0.83
R6378:Trappc12 UTSW 12 28747083 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAGGCGGCTTCAGGTATAGG -3'
(R):5'- ATCGGAATCAGGTGTTTCTCGG -3'

Sequencing Primer
(F):5'- GCTGTCAAGCCCAGTAACTAGG -3'
(R):5'- AGGTGTTTCTCGGGCCCC -3'
Posted On2016-10-06