Mutagenetix > Incidental Mutation

Incidental Mutation 'R5458:Ankhd1'

432903

Institutional Source

Beutler Lab

Gene Symbol

Ankhd1

Ensembl Gene

ENSMUSG00000024483

Gene Name

ankyrin repeat and KH domain containing 1

Synonyms

A530027J04Rik, 9130019P20Rik, 4933432B13Rik, 1110004O12Rik

MMRRC Submission

043021-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5458 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36693656-36791961 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36781538 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 2197 (S2197P)

Ref Sequence

ENSEMBL: ENSMUSP00000123270 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]

AlphaFold

E9PUR0

Predicted Effect

probably benign
Transcript: ENSMUST00000006205
AA Change: S2197P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: S2197P

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000037072
AA Change: S686P

SMART Domains

Protein: ENSMUSP00000040300
Gene: ENSMUSG00000024483
AA Change: S686P

Domain	Start	End	E-Value	Type
low complexity region	1	16	N/A	INTRINSIC
low complexity region	28	47	N/A	INTRINSIC
low complexity region	75	94	N/A	INTRINSIC
KH	183	253	5.04e-13	SMART
low complexity region	458	491	N/A	INTRINSIC
low complexity region	531	547	N/A	INTRINSIC
low complexity region	554	571	N/A	INTRINSIC
low complexity region	824	836	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000140061
AA Change: S209P

SMART Domains

Protein: ENSMUSP00000121811
Gene: ENSMUSG00000024483
AA Change: S209P

Domain	Start	End	E-Value	Type
low complexity region	54	70	N/A	INTRINSIC
low complexity region	77	94	N/A	INTRINSIC
low complexity region	355	375	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142977
AA Change: S2197P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: S2197P

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2334	2346	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152940

Predicted Effect

probably benign
Transcript: ENSMUST00000155329
AA Change: S2197P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: S2197P

Domain	Start	End	E-Value	Type
low complexity region	20	38	N/A	INTRINSIC
low complexity region	48	78	N/A	INTRINSIC
low complexity region	91	109	N/A	INTRINSIC
ANK	207	236	2.11e2	SMART
ANK	240	269	3.31e-1	SMART
ANK	274	303	5.24e-4	SMART
ANK	307	336	7.64e-6	SMART
ANK	340	369	2.7e-6	SMART
ANK	374	403	3.23e-4	SMART
ANK	407	436	1.61e-4	SMART
ANK	440	469	5.16e-3	SMART
ANK	473	502	4.16e-7	SMART
ANK	507	536	1.68e-2	SMART
ANK	537	566	7.02e-5	SMART
ANK	570	599	7.95e-4	SMART
ANK	603	632	4.56e-4	SMART
ANK	637	666	9.64e-3	SMART
ANK	670	699	6.71e-2	SMART
coiled coil region	815	855	N/A	INTRINSIC
ANK	1057	1086	2.07e-2	SMART
ANK	1090	1119	2.48e-5	SMART
ANK	1124	1153	3.85e-2	SMART
ANK	1157	1186	1.61e-4	SMART
ANK	1192	1221	1.24e-5	SMART
ANK	1226	1255	1.59e-3	SMART
ANK	1259	1288	3.91e-3	SMART
ANK	1294	1323	5.93e-3	SMART
ANK	1327	1356	9.41e-6	SMART
ANK	1360	1393	3.8e-1	SMART
coiled coil region	1422	1486	N/A	INTRINSIC
low complexity region	1509	1526	N/A	INTRINSIC
low complexity region	1538	1557	N/A	INTRINSIC
low complexity region	1585	1604	N/A	INTRINSIC
KH	1693	1763	5.04e-13	SMART
low complexity region	1968	2001	N/A	INTRINSIC
low complexity region	2041	2057	N/A	INTRINSIC
low complexity region	2064	2081	N/A	INTRINSIC
low complexity region	2342	2362	N/A	INTRINSIC

Meta Mutation Damage Score

0.0614

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acrbp	A	G	6: 125,027,013 (GRCm39)		probably benign	Het
Acsl5	A	G	19: 55,282,662 (GRCm39)	D589G	probably damaging	Het
Akap13	T	A	7: 75,236,049 (GRCm39)	L208Q	probably damaging	Het
Ankfn1	C	T	11: 89,325,636 (GRCm39)	R512K	probably benign	Het
Ankrd27	A	G	7: 35,291,236 (GRCm39)	N11D	probably damaging	Het
Aspg	T	C	12: 112,086,436 (GRCm39)	V230A	probably damaging	Het
Atp2c1	A	T	9: 105,291,924 (GRCm39)	Y709*	probably null	Het
Atp8b2	T	C	3: 89,853,329 (GRCm39)	N748D	probably benign	Het
B4galnt3	A	G	6: 120,187,346 (GRCm39)	V684A	probably damaging	Het
Bco2	T	C	9: 50,456,644 (GRCm39)		probably null	Het
Bcr	T	C	10: 74,990,792 (GRCm39)	V766A	probably benign	Het
Brca1	T	C	11: 101,408,111 (GRCm39)	N1404S	possibly damaging	Het
Cfap251	A	G	5: 123,392,508 (GRCm39)		probably benign	Het
Chd1	A	G	17: 15,958,811 (GRCm39)	D621G	probably damaging	Het
Chek1	A	G	9: 36,625,725 (GRCm39)	S307P	probably benign	Het
Dhx29	T	C	13: 113,103,155 (GRCm39)	M1345T	probably benign	Het
Dnah6	T	A	6: 73,063,168 (GRCm39)	T2697S	probably damaging	Het
Ephb4	T	C	5: 137,368,114 (GRCm39)	V753A	probably damaging	Het
Fat1	T	C	8: 45,466,090 (GRCm39)	Y1427H	probably damaging	Het
Fggy	A	G	4: 95,814,980 (GRCm39)	Q445R	probably benign	Het
Fv1	A	G	4: 147,954,726 (GRCm39)	S431G	probably benign	Het
Gm5965	A	T	16: 88,575,395 (GRCm39)	R189S	probably benign	Het
Gnas	A	G	2: 174,140,124 (GRCm39)	I98V	probably benign	Het
Ino80	T	C	2: 119,242,910 (GRCm39)	N1086D	possibly damaging	Het
Lclat1	T	C	17: 73,546,914 (GRCm39)	L277P	probably damaging	Het
Lipc	T	C	9: 70,759,864 (GRCm39)		probably benign	Het
Myo3a	T	C	2: 22,250,361 (GRCm39)	I76T	probably damaging	Het
Nkpd1	C	A	7: 19,258,201 (GRCm39)	A510E	probably damaging	Het
Nlgn2	G	T	11: 69,718,726 (GRCm39)	Q285K	possibly damaging	Het
Or8s5	G	A	15: 98,238,246 (GRCm39)	A208V	probably benign	Het
Pax5	T	C	4: 44,679,526 (GRCm39)	D172G	probably damaging	Het
Pcdh15	T	A	10: 74,340,611 (GRCm39)	V1115D	probably damaging	Het
Pdzd7	T	C	19: 45,016,230 (GRCm39)	S964G	probably benign	Het
Phip	G	T	9: 82,808,553 (GRCm39)	P474Q	probably benign	Het
Pop5	C	T	5: 115,378,496 (GRCm39)		probably benign	Het
Ppfibp1	A	T	6: 146,913,933 (GRCm39)		probably benign	Het
Rdh11	C	T	12: 79,235,279 (GRCm39)	A106T	probably benign	Het
Rin3	A	G	12: 102,339,975 (GRCm39)	T642A	probably damaging	Het
Scmh1	C	T	4: 120,362,478 (GRCm39)		probably benign	Het
Skint2	A	G	4: 112,481,377 (GRCm39)	H80R	possibly damaging	Het
Spata16	A	T	3: 26,831,686 (GRCm39)	N265I	probably damaging	Het
Srpk1	T	C	17: 28,818,446 (GRCm39)		probably null	Het
Tcaf1	T	C	6: 42,663,476 (GRCm39)	T135A	probably benign	Het
Trappc12	A	G	12: 28,796,389 (GRCm39)	V381A	probably damaging	Het
Trim33	T	A	3: 103,237,496 (GRCm39)	I184K	possibly damaging	Het
Unc13a	C	T	8: 72,116,889 (GRCm39)	V62M	probably damaging	Het
Vrk2	A	G	11: 26,448,919 (GRCm39)	V225A	probably damaging	Het
Wdr95	C	T	5: 149,487,879 (GRCm39)	P171L	probably damaging	Het
Wsb1	T	C	11: 79,139,262 (GRCm39)	T75A	probably damaging	Het

Other mutations in Ankhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Ankhd1	APN	18	36,798,512 (GRCm39)	unclassified	probably benign
IGL00927:Ankhd1	APN	18	36,765,125 (GRCm39)	missense	probably benign	0.01
IGL01367:Ankhd1	APN	18	36,711,696 (GRCm39)	missense	probably benign	0.16
IGL01624:Ankhd1	APN	18	36,791,066 (GRCm39)	missense	probably damaging	1.00
IGL01725:Ankhd1	APN	18	36,781,206 (GRCm39)	missense	probably benign	0.04
IGL01767:Ankhd1	APN	18	36,781,427 (GRCm39)	missense	probably damaging	1.00
IGL02005:Ankhd1	APN	18	36,781,479 (GRCm39)	missense	probably damaging	1.00
IGL02009:Ankhd1	APN	18	36,757,714 (GRCm39)	missense	probably damaging	1.00
IGL02246:Ankhd1	APN	18	36,789,779 (GRCm39)	missense	probably damaging	1.00
IGL02336:Ankhd1	APN	18	36,727,867 (GRCm39)	missense	probably damaging	0.97
IGL02628:Ankhd1	APN	18	36,780,756 (GRCm39)	missense	probably benign	0.00
IGL02644:Ankhd1	APN	18	36,711,828 (GRCm39)	critical splice donor site	probably null
IGL02735:Ankhd1	APN	18	36,781,599 (GRCm39)	missense	probably benign	0.00
IGL02877:Ankhd1	APN	18	36,727,876 (GRCm39)	missense	probably damaging	1.00
IGL03129:Ankhd1	APN	18	36,791,061 (GRCm39)	nonsense	probably null
IGL03163:Ankhd1	APN	18	36,780,681 (GRCm39)	missense	probably damaging	0.97
IGL03182:Ankhd1	APN	18	36,711,827 (GRCm39)	missense	probably benign	0.06
IGL03184:Ankhd1	APN	18	36,780,830 (GRCm39)	missense	probably damaging	1.00
IGL03398:Ankhd1	APN	18	36,789,890 (GRCm39)	splice site	probably benign
FR4304:Ankhd1	UTSW	18	36,693,977 (GRCm39)	small insertion	probably benign
R0051:Ankhd1	UTSW	18	36,780,241 (GRCm39)	unclassified	probably benign
R0089:Ankhd1	UTSW	18	36,773,409 (GRCm39)	missense	probably damaging	0.99
R0105:Ankhd1	UTSW	18	36,779,819 (GRCm39)	missense	probably damaging	1.00
R0149:Ankhd1	UTSW	18	36,780,267 (GRCm39)	missense	probably damaging	1.00
R0243:Ankhd1	UTSW	18	36,767,787 (GRCm39)	missense	probably damaging	1.00
R0322:Ankhd1	UTSW	18	36,791,061 (GRCm39)	nonsense	probably null
R0361:Ankhd1	UTSW	18	36,780,267 (GRCm39)	missense	probably damaging	1.00
R0389:Ankhd1	UTSW	18	36,777,652 (GRCm39)	missense	possibly damaging	0.48
R0418:Ankhd1	UTSW	18	36,767,353 (GRCm39)	missense	probably damaging	1.00
R0443:Ankhd1	UTSW	18	36,777,652 (GRCm39)	missense	possibly damaging	0.48
R0540:Ankhd1	UTSW	18	36,773,333 (GRCm39)	missense	probably damaging	1.00
R0607:Ankhd1	UTSW	18	36,773,333 (GRCm39)	missense	probably damaging	1.00
R0738:Ankhd1	UTSW	18	36,778,302 (GRCm39)	splice site	probably benign
R1127:Ankhd1	UTSW	18	36,767,399 (GRCm39)	missense	probably damaging	1.00
R1434:Ankhd1	UTSW	18	36,758,212 (GRCm39)	missense	probably benign	0.09
R1742:Ankhd1	UTSW	18	36,758,318 (GRCm39)	missense	probably damaging	1.00
R1776:Ankhd1	UTSW	18	36,780,361 (GRCm39)	missense	probably benign	0.17
R1856:Ankhd1	UTSW	18	36,777,580 (GRCm39)	missense	probably benign	0.00
R1923:Ankhd1	UTSW	18	36,781,083 (GRCm39)	missense	probably benign	0.08
R2044:Ankhd1	UTSW	18	36,778,166 (GRCm39)	missense	probably benign	0.31
R2112:Ankhd1	UTSW	18	36,774,679 (GRCm39)	missense	probably damaging	1.00
R2115:Ankhd1	UTSW	18	36,767,361 (GRCm39)	missense	probably damaging	1.00
R2136:Ankhd1	UTSW	18	36,780,674 (GRCm39)	missense	probably benign
R2196:Ankhd1	UTSW	18	36,781,432 (GRCm39)	missense	probably damaging	1.00
R2291:Ankhd1	UTSW	18	36,777,386 (GRCm39)	missense	probably benign	0.31
R2305:Ankhd1	UTSW	18	36,775,979 (GRCm39)	missense	possibly damaging	0.59
R2309:Ankhd1	UTSW	18	36,757,818 (GRCm39)	missense	probably damaging	1.00
R2519:Ankhd1	UTSW	18	36,711,596 (GRCm39)	splice site	probably null
R2958:Ankhd1	UTSW	18	36,767,782 (GRCm39)	missense	probably damaging	1.00
R3978:Ankhd1	UTSW	18	36,780,666 (GRCm39)	missense	probably damaging	0.96
R3980:Ankhd1	UTSW	18	36,780,666 (GRCm39)	missense	probably damaging	0.96
R4159:Ankhd1	UTSW	18	36,722,593 (GRCm39)	missense	possibly damaging	0.91
R4199:Ankhd1	UTSW	18	36,794,101 (GRCm39)	unclassified	probably benign
R4323:Ankhd1	UTSW	18	36,711,686 (GRCm39)	missense	probably damaging	1.00
R4356:Ankhd1	UTSW	18	36,776,096 (GRCm39)	nonsense	probably null
R4496:Ankhd1	UTSW	18	36,693,839 (GRCm39)	missense	probably damaging	0.98
R4551:Ankhd1	UTSW	18	36,788,560 (GRCm39)	splice site	probably null
R4590:Ankhd1	UTSW	18	36,716,697 (GRCm39)	missense	probably damaging	1.00
R4667:Ankhd1	UTSW	18	36,781,074 (GRCm39)	missense	possibly damaging	0.77
R4889:Ankhd1	UTSW	18	36,711,787 (GRCm39)	missense	probably null	0.00
R4923:Ankhd1	UTSW	18	36,722,505 (GRCm39)	missense	probably damaging	1.00
R5091:Ankhd1	UTSW	18	36,758,080 (GRCm39)	missense	possibly damaging	0.68
R5254:Ankhd1	UTSW	18	36,789,768 (GRCm39)	missense	probably benign	0.05
R5314:Ankhd1	UTSW	18	36,694,111 (GRCm39)	splice site	probably null
R5336:Ankhd1	UTSW	18	36,779,769 (GRCm39)	missense	probably damaging	1.00
R5367:Ankhd1	UTSW	18	36,722,461 (GRCm39)	missense	probably damaging	1.00
R5384:Ankhd1	UTSW	18	36,724,548 (GRCm39)	missense	probably damaging	1.00
R5385:Ankhd1	UTSW	18	36,724,548 (GRCm39)	missense	probably damaging	1.00
R5387:Ankhd1	UTSW	18	36,767,697 (GRCm39)	missense	probably damaging	1.00
R5599:Ankhd1	UTSW	18	36,693,860 (GRCm39)	missense	probably damaging	0.98
R5659:Ankhd1	UTSW	18	36,694,103 (GRCm39)	missense	probably damaging	1.00
R5750:Ankhd1	UTSW	18	36,757,955 (GRCm39)	missense	probably benign	0.00
R5874:Ankhd1	UTSW	18	36,773,322 (GRCm39)	missense	possibly damaging	0.92
R5894:Ankhd1	UTSW	18	36,780,577 (GRCm39)	missense	probably damaging	0.99
R5969:Ankhd1	UTSW	18	36,733,887 (GRCm39)	missense	probably damaging	1.00
R6133:Ankhd1	UTSW	18	36,758,179 (GRCm39)	missense	possibly damaging	0.77
R6190:Ankhd1	UTSW	18	36,744,862 (GRCm39)	missense	possibly damaging	0.84
R6247:Ankhd1	UTSW	18	36,787,199 (GRCm39)	missense	probably benign	0.00
R6512:Ankhd1	UTSW	18	36,724,509 (GRCm39)	missense	probably damaging	1.00
R6649:Ankhd1	UTSW	18	36,733,836 (GRCm39)	splice site	probably null
R6653:Ankhd1	UTSW	18	36,733,836 (GRCm39)	splice site	probably null
R6763:Ankhd1	UTSW	18	36,776,022 (GRCm39)	missense	probably benign	0.31
R6976:Ankhd1	UTSW	18	36,781,307 (GRCm39)	missense	probably benign	0.00
R7075:Ankhd1	UTSW	18	36,693,042 (GRCm39)	missense
R7208:Ankhd1	UTSW	18	36,758,081 (GRCm39)	missense	probably benign
R7305:Ankhd1	UTSW	18	36,765,258 (GRCm39)	missense
R7615:Ankhd1	UTSW	18	36,789,826 (GRCm39)	missense
R7654:Ankhd1	UTSW	18	36,727,154 (GRCm39)	missense	probably damaging	1.00
R7781:Ankhd1	UTSW	18	36,758,258 (GRCm39)	missense	probably damaging	1.00
R7842:Ankhd1	UTSW	18	36,780,881 (GRCm39)	missense	probably benign	0.00
R7965:Ankhd1	UTSW	18	36,791,465 (GRCm39)	missense
R8006:Ankhd1	UTSW	18	36,781,772 (GRCm39)	missense
R8037:Ankhd1	UTSW	18	36,771,676 (GRCm39)	missense	probably damaging	0.98
R8123:Ankhd1	UTSW	18	36,708,136 (GRCm39)	missense
R8195:Ankhd1	UTSW	18	36,787,230 (GRCm39)	missense
R8305:Ankhd1	UTSW	18	36,780,219 (GRCm39)	missense	possibly damaging	0.79
R8708:Ankhd1	UTSW	18	36,727,344 (GRCm39)	missense	probably damaging	1.00
R8827:Ankhd1	UTSW	18	36,757,633 (GRCm39)	nonsense	probably null
R9138:Ankhd1	UTSW	18	36,693,961 (GRCm39)	small deletion	probably benign
R9139:Ankhd1	UTSW	18	36,711,810 (GRCm39)	missense
R9186:Ankhd1	UTSW	18	36,767,383 (GRCm39)	missense	possibly damaging	0.95
R9245:Ankhd1	UTSW	18	36,788,653 (GRCm39)	missense
R9254:Ankhd1	UTSW	18	36,777,680 (GRCm39)	missense	probably benign	0.03
R9262:Ankhd1	UTSW	18	36,765,799 (GRCm39)	missense
R9379:Ankhd1	UTSW	18	36,777,680 (GRCm39)	missense	probably benign	0.03
R9436:Ankhd1	UTSW	18	36,774,654 (GRCm39)	missense	probably benign	0.04
R9436:Ankhd1	UTSW	18	36,694,041 (GRCm39)	missense	probably benign	0.39
R9541:Ankhd1	UTSW	18	36,757,697 (GRCm39)	missense
R9584:Ankhd1	UTSW	18	36,798,504 (GRCm39)	missense	probably benign	0.06
R9664:Ankhd1	UTSW	18	36,780,878 (GRCm39)	missense	probably benign	0.03
RF001:Ankhd1	UTSW	18	36,693,974 (GRCm39)	small insertion	probably benign
RF004:Ankhd1	UTSW	18	36,693,963 (GRCm39)	small insertion	probably benign
RF007:Ankhd1	UTSW	18	36,693,962 (GRCm39)	small insertion	probably benign
RF008:Ankhd1	UTSW	18	36,693,977 (GRCm39)	small insertion	probably benign
RF009:Ankhd1	UTSW	18	36,693,975 (GRCm39)	small insertion	probably benign
RF013:Ankhd1	UTSW	18	36,693,979 (GRCm39)	small insertion	probably benign
RF016:Ankhd1	UTSW	18	36,693,963 (GRCm39)	small insertion	probably benign
RF016:Ankhd1	UTSW	18	36,693,962 (GRCm39)	small insertion	probably benign
RF017:Ankhd1	UTSW	18	36,693,962 (GRCm39)	small insertion	probably benign
RF018:Ankhd1	UTSW	18	36,693,965 (GRCm39)	small insertion	probably benign
RF026:Ankhd1	UTSW	18	36,693,965 (GRCm39)	small insertion	probably benign
RF030:Ankhd1	UTSW	18	36,693,980 (GRCm39)	small insertion	probably benign
RF030:Ankhd1	UTSW	18	36,693,966 (GRCm39)	small insertion	probably benign
RF039:Ankhd1	UTSW	18	36,693,971 (GRCm39)	small insertion	probably benign
RF043:Ankhd1	UTSW	18	36,693,970 (GRCm39)	small insertion	probably benign
RF046:Ankhd1	UTSW	18	36,693,979 (GRCm39)	small insertion	probably benign
RF047:Ankhd1	UTSW	18	36,693,976 (GRCm39)	small insertion	probably benign
RF047:Ankhd1	UTSW	18	36,693,970 (GRCm39)	small insertion	probably benign
RF049:Ankhd1	UTSW	18	36,693,976 (GRCm39)	small insertion	probably benign
RF050:Ankhd1	UTSW	18	36,693,980 (GRCm39)	small insertion	probably benign
RF054:Ankhd1	UTSW	18	36,693,982 (GRCm39)	small insertion	probably benign
RF057:Ankhd1	UTSW	18	36,693,982 (GRCm39)	small insertion	probably benign
RF060:Ankhd1	UTSW	18	36,693,975 (GRCm39)	small insertion	probably benign
RF061:Ankhd1	UTSW	18	36,693,974 (GRCm39)	small insertion	probably benign
RF062:Ankhd1	UTSW	18	36,693,971 (GRCm39)	small insertion	probably benign
X0027:Ankhd1	UTSW	18	36,757,885 (GRCm39)	missense	probably damaging	1.00
X0065:Ankhd1	UTSW	18	36,711,817 (GRCm39)	nonsense	probably null
X0066:Ankhd1	UTSW	18	36,779,757 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTTCTCATCGAATGCAGCC -3'
(R):5'- GTTGTCAGGGTGCACATTTTCC -3'

Sequencing Primer
(F):5'- GAATGCAGCCCAGAGGTTCTTTTTAC -3'
(R):5'- GTGCACATTTTCCAAGTGTCCAAG -3'

Posted On

2016-10-06