Incidental Mutation 'R5459:Srp72'
ID432919
Institutional Source Beutler Lab
Gene Symbol Srp72
Ensembl Gene ENSMUSG00000036323
Gene Namesignal recognition particle 72
Synonyms72kDa, 5730576P14Rik
MMRRC Submission 043022-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.886) question?
Stock #R5459 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location76974683-76999937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76984338 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 258 (T258A)
Ref Sequence ENSEMBL: ENSMUSP00000098648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101087] [ENSMUST00000120550]
Predicted Effect probably benign
Transcript: ENSMUST00000101087
AA Change: T258A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098648
Gene: ENSMUSG00000036323
AA Change: T258A

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:TPR_9 19 70 2.7e-2 PFAM
Pfam:SRP_TPR_like 30 157 5.5e-25 PFAM
Pfam:TPR_8 176 208 2.3e-3 PFAM
Pfam:TPR_1 226 259 2.4e-4 PFAM
Pfam:TPR_2 226 259 4.9e-5 PFAM
Pfam:TPR_8 226 259 1.1e-2 PFAM
Pfam:TPR_9 412 490 1.3e-3 PFAM
Pfam:SRP72 531 588 6.2e-26 PFAM
low complexity region 630 639 N/A INTRINSIC
low complexity region 647 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120550
SMART Domains Protein: ENSMUSP00000113312
Gene: ENSMUSG00000036323

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:TPR_9 19 72 2.5e-2 PFAM
Blast:TPR 109 142 2e-11 BLAST
Blast:TPR 176 209 5e-10 BLAST
Pfam:TPR_6 280 310 2.5e-3 PFAM
Pfam:TPR_9 351 429 1.4e-3 PFAM
Pfam:SRP72 465 527 5.8e-24 PFAM
low complexity region 569 578 N/A INTRINSIC
low complexity region 586 607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150661
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 72 kDa subunit of the signal recognition particle (SRP), a ribonucleoprotein complex that mediates the targeting of secretory proteins to the endoplasmic reticulum (ER). The SRP complex consists of a 7S RNA and 6 protein subunits: SRP9, SRP14, SRP19, SRP54, SRP68, and SRP72, that are bound to the 7S RNA as monomers or heterodimers. SRP has at least 3 distinct functions that can be associated with the protein subunits: signal recognition, translational arrest, and ER membrane targeting by interaction with the docking protein. Mutations in this gene are associated with familial bone marrow failure. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,711,843 probably benign Het
2300002M23Rik A G 17: 35,568,182 E139G possibly damaging Het
4931408C20Rik A C 1: 26,685,191 S303A probably damaging Het
Abcc6 T C 7: 45,982,183 N1223S probably benign Het
Adamts3 A T 5: 89,691,473 probably null Het
Aloxe3 T A 11: 69,132,828 F259Y possibly damaging Het
Armc9 G A 1: 86,207,972 R550Q probably damaging Het
Ctnnd2 A G 15: 30,887,188 D787G probably damaging Het
Dnah7b A G 1: 46,109,312 I283V probably null Het
Ebf2 A G 14: 67,235,201 M23V probably benign Het
Fbxw11 T C 11: 32,739,191 V438A possibly damaging Het
Fcrla G A 1: 170,918,169 T348M possibly damaging Het
Gpr179 A T 11: 97,336,657 H1557Q probably benign Het
Gpr87 A G 3: 59,179,727 V119A possibly damaging Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hs3st5 T C 10: 36,828,746 V15A possibly damaging Het
Hyal5 C T 6: 24,891,251 H355Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map4k3 T A 17: 80,609,787 N587Y probably damaging Het
Mcm3ap T A 10: 76,496,482 L1211* probably null Het
Mcmdc2 A G 1: 9,937,084 I620V probably benign Het
Micalcl C T 7: 112,382,237 H539Y probably benign Het
Myo9a T C 9: 59,884,520 L1802P probably damaging Het
Neto2 T A 8: 85,670,483 I47F probably benign Het
Olfr1443 A G 19: 12,680,435 E109G probably damaging Het
Oog3 G A 4: 144,159,245 T261I probably benign Het
Pdilt A G 7: 119,486,935 L519P probably benign Het
Pnpla6 A T 8: 3,535,829 M844L probably benign Het
Polk C T 13: 96,495,476 G250R probably damaging Het
Rasal2 A G 1: 157,157,661 S839P probably damaging Het
Siae T C 9: 37,616,823 Y31H probably damaging Het
Slc27a2 T C 2: 126,580,992 V379A probably damaging Het
Snx9 C T 17: 5,920,638 T418M probably damaging Het
Tango6 T A 8: 106,850,289 D1058E probably damaging Het
Tecpr1 T A 5: 144,207,416 Y656F probably damaging Het
Tnik T A 3: 28,661,741 I1168K probably damaging Het
Togaram1 A G 12: 64,967,736 E587G probably damaging Het
Tyw1 A C 5: 130,274,706 D305A probably damaging Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Zkscan3 A T 13: 21,394,812 V142E probably damaging Het
Other mutations in Srp72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Srp72 APN 5 76984176 missense probably damaging 1.00
IGL00915:Srp72 APN 5 76978613 nonsense probably null
IGL02731:Srp72 APN 5 76994215 missense probably damaging 0.98
PIT4468001:Srp72 UTSW 5 76994206 missense probably benign
R0009:Srp72 UTSW 5 76987885 missense probably damaging 0.98
R0318:Srp72 UTSW 5 76984200 missense probably benign 0.27
R1645:Srp72 UTSW 5 76998278 missense probably benign 0.05
R1678:Srp72 UTSW 5 76980307 missense probably damaging 1.00
R1682:Srp72 UTSW 5 76987870 missense possibly damaging 0.95
R2037:Srp72 UTSW 5 76976491 missense probably damaging 1.00
R2364:Srp72 UTSW 5 76984362 missense probably benign 0.00
R2876:Srp72 UTSW 5 76995920 splice site probably benign
R4072:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4073:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4074:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4638:Srp72 UTSW 5 76990295 missense probably benign 0.00
R4803:Srp72 UTSW 5 76984384 missense probably damaging 0.97
R4864:Srp72 UTSW 5 76984162 missense probably benign 0.35
R5188:Srp72 UTSW 5 76974751 missense possibly damaging 0.54
R5217:Srp72 UTSW 5 76980528 missense probably damaging 1.00
R5616:Srp72 UTSW 5 76987934 missense probably damaging 1.00
R6460:Srp72 UTSW 5 76987991 missense probably damaging 1.00
R6595:Srp72 UTSW 5 76984200 missense probably benign 0.27
R6959:Srp72 UTSW 5 76994223 missense possibly damaging 0.91
R6986:Srp72 UTSW 5 76994876 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGGCGTACATCATGCAGCTG -3'
(R):5'- AGCTTTACTAACGGCCAAGGC -3'

Sequencing Primer
(F):5'- TGCAGGGTCGCACAGAG -3'
(R):5'- GGCCTACAACTACAAAGATGATTTAC -3'
Posted On2016-10-06