Incidental Mutation 'R5459:Tango6'
ID432931
Institutional Source Beutler Lab
Gene Symbol Tango6
Ensembl Gene ENSMUSG00000041949
Gene Nametransport and golgi organization 6
Synonyms
MMRRC Submission 043022-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R5459 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106683068-106851439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106850289 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1058 (D1058E)
Ref Sequence ENSEMBL: ENSMUSP00000043953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048359]
Predicted Effect probably damaging
Transcript: ENSMUST00000048359
AA Change: D1058E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043953
Gene: ENSMUSG00000041949
AA Change: D1058E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 20 41 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
low complexity region 334 350 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
Pfam:RTP1_C1 824 935 1.6e-35 PFAM
low complexity region 998 1013 N/A INTRINSIC
Pfam:RTP1_C2 1026 1059 7.5e-14 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,711,843 probably benign Het
2300002M23Rik A G 17: 35,568,182 E139G possibly damaging Het
4931408C20Rik A C 1: 26,685,191 S303A probably damaging Het
Abcc6 T C 7: 45,982,183 N1223S probably benign Het
Adamts3 A T 5: 89,691,473 probably null Het
Aloxe3 T A 11: 69,132,828 F259Y possibly damaging Het
Armc9 G A 1: 86,207,972 R550Q probably damaging Het
Ctnnd2 A G 15: 30,887,188 D787G probably damaging Het
Dnah7b A G 1: 46,109,312 I283V probably null Het
Ebf2 A G 14: 67,235,201 M23V probably benign Het
Fbxw11 T C 11: 32,739,191 V438A possibly damaging Het
Fcrla G A 1: 170,918,169 T348M possibly damaging Het
Gpr179 A T 11: 97,336,657 H1557Q probably benign Het
Gpr87 A G 3: 59,179,727 V119A possibly damaging Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hs3st5 T C 10: 36,828,746 V15A possibly damaging Het
Hyal5 C T 6: 24,891,251 H355Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map4k3 T A 17: 80,609,787 N587Y probably damaging Het
Mcm3ap T A 10: 76,496,482 L1211* probably null Het
Mcmdc2 A G 1: 9,937,084 I620V probably benign Het
Micalcl C T 7: 112,382,237 H539Y probably benign Het
Myo9a T C 9: 59,884,520 L1802P probably damaging Het
Neto2 T A 8: 85,670,483 I47F probably benign Het
Olfr1443 A G 19: 12,680,435 E109G probably damaging Het
Oog3 G A 4: 144,159,245 T261I probably benign Het
Pdilt A G 7: 119,486,935 L519P probably benign Het
Pnpla6 A T 8: 3,535,829 M844L probably benign Het
Polk C T 13: 96,495,476 G250R probably damaging Het
Rasal2 A G 1: 157,157,661 S839P probably damaging Het
Siae T C 9: 37,616,823 Y31H probably damaging Het
Slc27a2 T C 2: 126,580,992 V379A probably damaging Het
Snx9 C T 17: 5,920,638 T418M probably damaging Het
Srp72 A G 5: 76,984,338 T258A probably benign Het
Tecpr1 T A 5: 144,207,416 Y656F probably damaging Het
Tnik T A 3: 28,661,741 I1168K probably damaging Het
Togaram1 A G 12: 64,967,736 E587G probably damaging Het
Tyw1 A C 5: 130,274,706 D305A probably damaging Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Zkscan3 A T 13: 21,394,812 V142E probably damaging Het
Other mutations in Tango6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Tango6 APN 8 106742472 critical splice donor site probably null
IGL00925:Tango6 APN 8 106695445 splice site probably benign
IGL00965:Tango6 APN 8 106742010 splice site probably benign
IGL01412:Tango6 APN 8 106818499 missense probably benign 0.02
IGL02888:Tango6 APN 8 106720665 missense probably damaging 1.00
IGL02892:Tango6 APN 8 106742010 splice site probably benign
R0241:Tango6 UTSW 8 106747361 splice site probably benign
R0494:Tango6 UTSW 8 106735682 splice site probably benign
R1127:Tango6 UTSW 8 106688895 missense probably benign 0.00
R1440:Tango6 UTSW 8 106689039 missense probably damaging 1.00
R1547:Tango6 UTSW 8 106781786 missense probably damaging 0.98
R1921:Tango6 UTSW 8 106688794 missense probably benign 0.06
R2255:Tango6 UTSW 8 106689294 critical splice donor site probably null
R2761:Tango6 UTSW 8 106699032 missense possibly damaging 0.93
R4211:Tango6 UTSW 8 106689224 missense probably benign 0.02
R4463:Tango6 UTSW 8 106689074 missense probably benign 0.29
R4696:Tango6 UTSW 8 106700231 missense possibly damaging 0.73
R4867:Tango6 UTSW 8 106818526 missense probably damaging 1.00
R4946:Tango6 UTSW 8 106718090 nonsense probably null
R5522:Tango6 UTSW 8 106695598 critical splice donor site probably null
R5795:Tango6 UTSW 8 106718077 missense probably damaging 1.00
R5878:Tango6 UTSW 8 106689168 missense possibly damaging 0.77
R6318:Tango6 UTSW 8 106818497 missense probably benign
R6335:Tango6 UTSW 8 106692676 missense possibly damaging 0.94
R6633:Tango6 UTSW 8 106718005 missense probably benign 0.00
R6664:Tango6 UTSW 8 106742114 missense probably damaging 1.00
R6838:Tango6 UTSW 8 106742074 missense probably benign 0.00
R6866:Tango6 UTSW 8 106742472 critical splice donor site probably null
R7046:Tango6 UTSW 8 106807116 missense possibly damaging 0.86
R7130:Tango6 UTSW 8 106807101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCCCTGCATTATCTTACAAGG -3'
(R):5'- TGCCAGCACCGTATAGCTAC -3'

Sequencing Primer
(F):5'- TTATCTTACAAGGACGCCAGAGACTG -3'
(R):5'- CTTCAGGTTATAGCAGACCTCAGG -3'
Posted On2016-10-06