Incidental Mutation 'R5459:Siae'
ID432932
Institutional Source Beutler Lab
Gene Symbol Siae
Ensembl Gene ENSMUSG00000001942
Gene Namesialic acid acetylesterase
SynonymsLSE, clone 165, Ysg2
MMRRC Submission 043022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5459 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location37555698-37649655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37616823 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 31 (Y31H)
Ref Sequence ENSEMBL: ENSMUSP00000149505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002007] [ENSMUST00000002013] [ENSMUST00000213126] [ENSMUST00000214786] [ENSMUST00000215474] [ENSMUST00000215829]
Predicted Effect probably benign
Transcript: ENSMUST00000002007
SMART Domains Protein: ENSMUSP00000002007
Gene: ENSMUSG00000001942

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:DUF303 118 420 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000002013
SMART Domains Protein: ENSMUSP00000002013
Gene: ENSMUSG00000001948

DomainStartEndE-ValueType
RIIa 14 51 7.04e-15 SMART
low complexity region 75 86 N/A INTRINSIC
IQ 111 133 7.4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213126
Predicted Effect probably benign
Transcript: ENSMUST00000214786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215336
Predicted Effect probably damaging
Transcript: ENSMUST00000215474
AA Change: Y31H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215678
Predicted Effect probably benign
Transcript: ENSMUST00000215829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217567
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which removes 9-O-acetylation modifications from sialic acids. Mutations in this gene are associated with susceptibility to autoimmune disease 6. Multiple transcript variants encoding different isoforms, found either in the cytosol or in the lysosome, have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit normal marginal zone B cell and memory phenotype T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,711,843 probably benign Het
2300002M23Rik A G 17: 35,568,182 E139G possibly damaging Het
4931408C20Rik A C 1: 26,685,191 S303A probably damaging Het
Abcc6 T C 7: 45,982,183 N1223S probably benign Het
Adamts3 A T 5: 89,691,473 probably null Het
Aloxe3 T A 11: 69,132,828 F259Y possibly damaging Het
Armc9 G A 1: 86,207,972 R550Q probably damaging Het
Ctnnd2 A G 15: 30,887,188 D787G probably damaging Het
Dnah7b A G 1: 46,109,312 I283V probably null Het
Ebf2 A G 14: 67,235,201 M23V probably benign Het
Fbxw11 T C 11: 32,739,191 V438A possibly damaging Het
Fcrla G A 1: 170,918,169 T348M possibly damaging Het
Gpr179 A T 11: 97,336,657 H1557Q probably benign Het
Gpr87 A G 3: 59,179,727 V119A possibly damaging Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hs3st5 T C 10: 36,828,746 V15A possibly damaging Het
Hyal5 C T 6: 24,891,251 H355Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map4k3 T A 17: 80,609,787 N587Y probably damaging Het
Mcm3ap T A 10: 76,496,482 L1211* probably null Het
Mcmdc2 A G 1: 9,937,084 I620V probably benign Het
Micalcl C T 7: 112,382,237 H539Y probably benign Het
Myo9a T C 9: 59,884,520 L1802P probably damaging Het
Neto2 T A 8: 85,670,483 I47F probably benign Het
Olfr1443 A G 19: 12,680,435 E109G probably damaging Het
Oog3 G A 4: 144,159,245 T261I probably benign Het
Pdilt A G 7: 119,486,935 L519P probably benign Het
Pnpla6 A T 8: 3,535,829 M844L probably benign Het
Polk C T 13: 96,495,476 G250R probably damaging Het
Rasal2 A G 1: 157,157,661 S839P probably damaging Het
Slc27a2 T C 2: 126,580,992 V379A probably damaging Het
Snx9 C T 17: 5,920,638 T418M probably damaging Het
Srp72 A G 5: 76,984,338 T258A probably benign Het
Tango6 T A 8: 106,850,289 D1058E probably damaging Het
Tecpr1 T A 5: 144,207,416 Y656F probably damaging Het
Tnik T A 3: 28,661,741 I1168K probably damaging Het
Togaram1 A G 12: 64,967,736 E587G probably damaging Het
Tyw1 A C 5: 130,274,706 D305A probably damaging Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Zkscan3 A T 13: 21,394,812 V142E probably damaging Het
Other mutations in Siae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Siae APN 9 37631486 missense probably damaging 0.98
IGL02696:Siae APN 9 37631384 missense probably damaging 1.00
R0531:Siae UTSW 9 37627794 missense probably benign 0.04
R1138:Siae UTSW 9 37642692 missense probably damaging 1.00
R1748:Siae UTSW 9 37631606 critical splice donor site probably null
R2175:Siae UTSW 9 37627796 missense probably damaging 1.00
R4301:Siae UTSW 9 37633713 missense possibly damaging 0.51
R4887:Siae UTSW 9 37627800 missense possibly damaging 0.93
R4989:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5133:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5134:Siae UTSW 9 37646520 missense possibly damaging 0.79
R5151:Siae UTSW 9 37631573 missense probably benign 0.02
R5242:Siae UTSW 9 37644852 missense probably damaging 1.00
R5571:Siae UTSW 9 37616923 missense probably benign 0.01
R6335:Siae UTSW 9 37632981 missense probably benign 0.03
R6552:Siae UTSW 9 37646400 missense possibly damaging 0.57
R6692:Siae UTSW 9 37642799 critical splice donor site probably null
R6694:Siae UTSW 9 37616823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGTCATGTTCTGCTGTGATAC -3'
(R):5'- TCATTTTCAGATAATCCAGCAGGTG -3'

Sequencing Primer
(F):5'- TTTAATCTGGAGCAACTGGACCCG -3'
(R):5'- TGGCAGAAGAGGACAATAACTGAAC -3'
Posted On2016-10-06