Incidental Mutation 'R5459:Aloxe3'
ID432939
Institutional Source Beutler Lab
Gene Symbol Aloxe3
Ensembl Gene ENSMUSG00000020892
Gene Namearachidonate lipoxygenase 3
Synonymse-LOX-3
MMRRC Submission 043022-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5459 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69125896-69149115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69132828 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 259 (F259Y)
Ref Sequence ENSEMBL: ENSMUSP00000134814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021268] [ENSMUST00000175661]
Predicted Effect probably benign
Transcript: ENSMUST00000021268
AA Change: F259Y

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021268
Gene: ENSMUSG00000020892
AA Change: F259Y

DomainStartEndE-ValueType
LH2 2 116 1.93e-20 SMART
Pfam:Lipoxygenase 249 697 3.4e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156874
Predicted Effect possibly damaging
Transcript: ENSMUST00000175661
AA Change: F259Y

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134814
Gene: ENSMUSG00000020892
AA Change: F259Y

DomainStartEndE-ValueType
LH2 2 116 1.93e-20 SMART
Pfam:Lipoxygenase 245 377 7.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176087
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoxygenase family, which are catabolized by arachidonic acid-derived compounds. The encoded enzyme is a hydroperoxide isomerase that synthesizes a unique type of epoxy alcohol (8R-hydroxy-11R,12R-epoxyeicosa-5Z,9E,14Z-trienoic acid) from 12R-hydroperoxyeicosatetraenoic acid (12R-HPETE). This epoxy alcohol can activate the the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha), which is implicated in epidermal differentiation. Loss of function of the enzyme encoded by this gene results in ichthyosis, implicating the function of this gene in the differentiation of human skin. This gene is part of a cluster of lipoxygenase genes on 17p13.1. Mutations in this gene result in nonbullous congenital ichthyosiform erythroderma (NCIE). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality, imapired skin barrier function, dehydration, tightly packed stratum corneum, impaired stratum corneum desquamation and reduced levels of ester-bound ceramide in the epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,711,843 probably benign Het
2300002M23Rik A G 17: 35,568,182 E139G possibly damaging Het
4931408C20Rik A C 1: 26,685,191 S303A probably damaging Het
Abcc6 T C 7: 45,982,183 N1223S probably benign Het
Adamts3 A T 5: 89,691,473 probably null Het
Armc9 G A 1: 86,207,972 R550Q probably damaging Het
Ctnnd2 A G 15: 30,887,188 D787G probably damaging Het
Dnah7b A G 1: 46,109,312 I283V probably null Het
Ebf2 A G 14: 67,235,201 M23V probably benign Het
Fbxw11 T C 11: 32,739,191 V438A possibly damaging Het
Fcrla G A 1: 170,918,169 T348M possibly damaging Het
Gpr179 A T 11: 97,336,657 H1557Q probably benign Het
Gpr87 A G 3: 59,179,727 V119A possibly damaging Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hs3st5 T C 10: 36,828,746 V15A possibly damaging Het
Hyal5 C T 6: 24,891,251 H355Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map4k3 T A 17: 80,609,787 N587Y probably damaging Het
Mcm3ap T A 10: 76,496,482 L1211* probably null Het
Mcmdc2 A G 1: 9,937,084 I620V probably benign Het
Micalcl C T 7: 112,382,237 H539Y probably benign Het
Myo9a T C 9: 59,884,520 L1802P probably damaging Het
Neto2 T A 8: 85,670,483 I47F probably benign Het
Olfr1443 A G 19: 12,680,435 E109G probably damaging Het
Oog3 G A 4: 144,159,245 T261I probably benign Het
Pdilt A G 7: 119,486,935 L519P probably benign Het
Pnpla6 A T 8: 3,535,829 M844L probably benign Het
Polk C T 13: 96,495,476 G250R probably damaging Het
Rasal2 A G 1: 157,157,661 S839P probably damaging Het
Siae T C 9: 37,616,823 Y31H probably damaging Het
Slc27a2 T C 2: 126,580,992 V379A probably damaging Het
Snx9 C T 17: 5,920,638 T418M probably damaging Het
Srp72 A G 5: 76,984,338 T258A probably benign Het
Tango6 T A 8: 106,850,289 D1058E probably damaging Het
Tecpr1 T A 5: 144,207,416 Y656F probably damaging Het
Tnik T A 3: 28,661,741 I1168K probably damaging Het
Togaram1 A G 12: 64,967,736 E587G probably damaging Het
Tyw1 A C 5: 130,274,706 D305A probably damaging Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Zkscan3 A T 13: 21,394,812 V142E probably damaging Het
Other mutations in Aloxe3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Aloxe3 APN 11 69130013 missense probably benign 0.41
IGL01925:Aloxe3 APN 11 69128633 missense probably damaging 1.00
IGL01947:Aloxe3 APN 11 69143021 splice site probably benign
IGL02421:Aloxe3 APN 11 69130046 missense possibly damaging 0.87
IGL03206:Aloxe3 APN 11 69129646 missense possibly damaging 0.74
IGL03054:Aloxe3 UTSW 11 69129607 missense possibly damaging 0.78
R1613:Aloxe3 UTSW 11 69130046 missense possibly damaging 0.87
R1757:Aloxe3 UTSW 11 69135949 missense possibly damaging 0.72
R1839:Aloxe3 UTSW 11 69130085 missense probably damaging 1.00
R2182:Aloxe3 UTSW 11 69129600 missense possibly damaging 0.93
R2912:Aloxe3 UTSW 11 69130040 missense probably damaging 1.00
R2919:Aloxe3 UTSW 11 69142923 missense probably damaging 0.99
R2920:Aloxe3 UTSW 11 69142923 missense probably damaging 0.99
R4731:Aloxe3 UTSW 11 69128654 missense probably null 0.59
R5245:Aloxe3 UTSW 11 69129676 missense probably benign 0.00
R5493:Aloxe3 UTSW 11 69128617 nonsense probably null
R5725:Aloxe3 UTSW 11 69128654 missense probably null 0.59
R5755:Aloxe3 UTSW 11 69132749 missense probably benign 0.04
R5789:Aloxe3 UTSW 11 69126439 missense probably damaging 1.00
X0019:Aloxe3 UTSW 11 69148735 missense probably damaging 1.00
X0020:Aloxe3 UTSW 11 69133027 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATGAACCCACTGATTCTCTCCAG -3'
(R):5'- TCACACCAATGCTCGGTGAC -3'

Sequencing Primer
(F):5'- GATTCTCTCCAGCCACGAG -3'
(R):5'- ACGTACTCTGGTGGGGG -3'
Posted On2016-10-06