Incidental Mutation 'R5459:Zkscan3'
ID432942
Institutional Source Beutler Lab
Gene Symbol Zkscan3
Ensembl Gene ENSMUSG00000021327
Gene Namezinc finger with KRAB and SCAN domains 3
SynonymsZfp306, 2810435N07Rik, Zfp307, Skz1
MMRRC Submission 043022-MU
Accession Numbers

Genbank: NM_001145778, NM_023685; MGI: 1919989

Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R5459 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21387003-21402755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21394812 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 142 (V142E)
Ref Sequence ENSEMBL: ENSMUSP00000153231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070785] [ENSMUST00000116433] [ENSMUST00000116434] [ENSMUST00000117721] [ENSMUST00000223831] [ENSMUST00000224820]
Predicted Effect probably benign
Transcript: ENSMUST00000070785
AA Change: V171E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068424
Gene: ENSMUSG00000021327
AA Change: V171E

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 4.07e-6 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 1.38e-3 SMART
ZnF_C2H2 369 391 9.88e-5 SMART
ZnF_C2H2 397 419 1.95e-3 SMART
ZnF_C2H2 425 447 3.95e-4 SMART
ZnF_C2H2 479 501 5.21e-4 SMART
ZnF_C2H2 507 529 1.2e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116433
AA Change: V171E

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112134
Gene: ENSMUSG00000021327
AA Change: V171E

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116434
AA Change: V171E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112135
Gene: ENSMUSG00000021327
AA Change: V171E

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 273 4.07e-6 SMART
ZnF_C2H2 313 335 4.17e-3 SMART
ZnF_C2H2 341 363 1.38e-3 SMART
ZnF_C2H2 369 391 9.88e-5 SMART
ZnF_C2H2 397 419 1.95e-3 SMART
ZnF_C2H2 425 447 3.95e-4 SMART
ZnF_C2H2 479 501 5.21e-4 SMART
ZnF_C2H2 507 529 1.2e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117721
AA Change: V171E

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112862
Gene: ENSMUSG00000021327
AA Change: V171E

DomainStartEndE-ValueType
SCAN 47 159 4.18e-71 SMART
KRAB 213 256 3.96e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184464
Predicted Effect possibly damaging
Transcript: ENSMUST00000223831
AA Change: V4E

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000224820
AA Change: V142E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,711,843 probably benign Het
2300002M23Rik A G 17: 35,568,182 E139G possibly damaging Het
4931408C20Rik A C 1: 26,685,191 S303A probably damaging Het
Abcc6 T C 7: 45,982,183 N1223S probably benign Het
Adamts3 A T 5: 89,691,473 probably null Het
Aloxe3 T A 11: 69,132,828 F259Y possibly damaging Het
Armc9 G A 1: 86,207,972 R550Q probably damaging Het
Ctnnd2 A G 15: 30,887,188 D787G probably damaging Het
Dnah7b A G 1: 46,109,312 I283V probably null Het
Ebf2 A G 14: 67,235,201 M23V probably benign Het
Fbxw11 T C 11: 32,739,191 V438A possibly damaging Het
Fcrla G A 1: 170,918,169 T348M possibly damaging Het
Gpr179 A T 11: 97,336,657 H1557Q probably benign Het
Gpr87 A G 3: 59,179,727 V119A possibly damaging Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hs3st5 T C 10: 36,828,746 V15A possibly damaging Het
Hyal5 C T 6: 24,891,251 H355Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map4k3 T A 17: 80,609,787 N587Y probably damaging Het
Mcm3ap T A 10: 76,496,482 L1211* probably null Het
Mcmdc2 A G 1: 9,937,084 I620V probably benign Het
Micalcl C T 7: 112,382,237 H539Y probably benign Het
Myo9a T C 9: 59,884,520 L1802P probably damaging Het
Neto2 T A 8: 85,670,483 I47F probably benign Het
Olfr1443 A G 19: 12,680,435 E109G probably damaging Het
Oog3 G A 4: 144,159,245 T261I probably benign Het
Pdilt A G 7: 119,486,935 L519P probably benign Het
Pnpla6 A T 8: 3,535,829 M844L probably benign Het
Polk C T 13: 96,495,476 G250R probably damaging Het
Rasal2 A G 1: 157,157,661 S839P probably damaging Het
Siae T C 9: 37,616,823 Y31H probably damaging Het
Slc27a2 T C 2: 126,580,992 V379A probably damaging Het
Snx9 C T 17: 5,920,638 T418M probably damaging Het
Srp72 A G 5: 76,984,338 T258A probably benign Het
Tango6 T A 8: 106,850,289 D1058E probably damaging Het
Tecpr1 T A 5: 144,207,416 Y656F probably damaging Het
Tnik T A 3: 28,661,741 I1168K probably damaging Het
Togaram1 A G 12: 64,967,736 E587G probably damaging Het
Tyw1 A C 5: 130,274,706 D305A probably damaging Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Other mutations in Zkscan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Zkscan3 APN 13 21394091 splice site probably benign
IGL02406:Zkscan3 APN 13 21388178 missense possibly damaging 0.71
IGL02725:Zkscan3 APN 13 21394893 missense possibly damaging 0.85
IGL02741:Zkscan3 APN 13 21393994 missense probably benign 0.05
3-1:Zkscan3 UTSW 13 21387881 missense probably benign 0.32
R0040:Zkscan3 UTSW 13 21394920 splice site probably null
R0040:Zkscan3 UTSW 13 21394920 splice site probably null
R0133:Zkscan3 UTSW 13 21394774 missense possibly damaging 0.73
R0660:Zkscan3 UTSW 13 21388460 missense probably damaging 1.00
R0737:Zkscan3 UTSW 13 21388596 missense probably benign
R1250:Zkscan3 UTSW 13 21388524 missense probably benign 0.32
R1671:Zkscan3 UTSW 13 21396135 missense possibly damaging 0.93
R1926:Zkscan3 UTSW 13 21396446 missense possibly damaging 0.88
R2899:Zkscan3 UTSW 13 21393973 missense probably damaging 1.00
R4119:Zkscan3 UTSW 13 21393949 missense possibly damaging 0.65
R4120:Zkscan3 UTSW 13 21393949 missense possibly damaging 0.65
R4606:Zkscan3 UTSW 13 21393783 missense probably benign 0.00
R5549:Zkscan3 UTSW 13 21394063 missense probably damaging 1.00
R5631:Zkscan3 UTSW 13 21394533 missense probably damaging 1.00
R5988:Zkscan3 UTSW 13 21396291 missense probably damaging 1.00
R6495:Zkscan3 UTSW 13 21387905 missense probably damaging 0.97
Z1088:Zkscan3 UTSW 13 21388565 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGCCTAGTAGCTGTCACTCC -3'
(R):5'- GCCAAGCTGATAGGAAATGTC -3'

Sequencing Primer
(F):5'- GTGAGACTCACTCTAGCATCAG -3'
(R):5'- CCAAGCTGATAGGAAATGTCTTTGG -3'
Posted On2016-10-06