Incidental Mutation 'R5465:Ralgapb'
ID433196
Institutional Source Beutler Lab
Gene Symbol Ralgapb
Ensembl Gene ENSMUSG00000027652
Gene NameRal GTPase activating protein, beta subunit (non-catalytic)
SynonymsB230339M05Rik
MMRRC Submission 043026-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5465 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location158409848-158499253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 158448405 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 412 (T412N)
Ref Sequence ENSEMBL: ENSMUSP00000116481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046274] [ENSMUST00000109485] [ENSMUST00000109486] [ENSMUST00000141497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046274
AA Change: T734N

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048430
Gene: ENSMUSG00000027652
AA Change: T734N

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
low complexity region 775 788 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1309 1321 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109485
AA Change: T746N

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105111
Gene: ENSMUSG00000027652
AA Change: T746N

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 926 936 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1325 1337 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109486
AA Change: T734N

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105112
Gene: ENSMUSG00000027652
AA Change: T734N

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 914 924 N/A INTRINSIC
low complexity region 1090 1101 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000141497
AA Change: T412N

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116481
Gene: ENSMUSG00000027652
AA Change: T412N

DomainStartEndE-ValueType
low complexity region 288 303 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 768 779 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp1 T C 7: 30,436,852 D500G probably benign Het
Atg7 G A 6: 114,652,532 G4R probably benign Het
Atp11b G A 3: 35,810,184 V302I probably benign Het
Cacna1b C T 2: 24,650,426 probably null Het
Ccna1 T C 3: 55,045,644 H234R probably benign Het
Cplx2 G A 13: 54,379,539 E79K possibly damaging Het
Gnb2 A G 5: 137,528,513 I380T probably damaging Het
Gpr162 A T 6: 124,861,171 V172D probably damaging Het
Gtf2a1 A C 12: 91,567,791 F191V possibly damaging Het
Ift172 A T 5: 31,261,518 probably null Het
Khdrbs2 T C 1: 32,619,174 Y272H probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Map1a T C 2: 121,306,025 S2203P probably damaging Het
Map3k1 A T 13: 111,756,120 L867Q probably benign Het
Ncapd2 A T 6: 125,176,783 F656L probably damaging Het
Olfr1356 T C 10: 78,847,018 K299R probably benign Het
Olfr1463 T C 19: 13,234,688 I146T probably benign Het
Olfr561 A G 7: 102,775,433 K303R probably benign Het
Pcdhb6 A T 18: 37,334,730 I235F probably damaging Het
Pzp A G 6: 128,486,961 S1395P probably damaging Het
Rtn4r A T 16: 18,151,427 M240L probably benign Het
Slit2 C T 5: 48,249,912 T895I probably damaging Het
Slx4ip T G 2: 137,004,947 L44R probably damaging Het
Sptbn2 C A 19: 4,750,105 Q2196K probably benign Het
Tbc1d16 G A 11: 119,156,059 S454L probably benign Het
Tet1 T C 10: 62,839,777 H840R probably benign Het
Usp47 C T 7: 112,059,002 T176M probably damaging Het
Utp6 A T 11: 79,949,010 I284N probably benign Het
Vcpip1 T C 1: 9,747,147 H337R probably benign Het
Wdr78 T A 4: 103,049,561 D685V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Ralgapb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ralgapb APN 2 158420856 missense probably damaging 1.00
IGL00534:Ralgapb APN 2 158430500 missense possibly damaging 0.72
IGL01362:Ralgapb APN 2 158435465 missense probably damaging 1.00
IGL01653:Ralgapb APN 2 158462159 missense possibly damaging 0.94
IGL01704:Ralgapb APN 2 158420875 missense possibly damaging 0.92
IGL02000:Ralgapb APN 2 158454114 splice site probably benign
IGL02169:Ralgapb APN 2 158426204 missense probably damaging 1.00
IGL02516:Ralgapb APN 2 158465815 splice site probably benign
IGL02548:Ralgapb APN 2 158444665 missense probably damaging 0.97
IGL02550:Ralgapb APN 2 158448411 missense probably damaging 1.00
IGL02653:Ralgapb APN 2 158443309 missense probably damaging 1.00
IGL02744:Ralgapb APN 2 158446151 missense probably damaging 1.00
IGL02804:Ralgapb APN 2 158426284 missense possibly damaging 0.78
IGL02937:Ralgapb APN 2 158493016 splice site probably null
IGL02993:Ralgapb APN 2 158437394 missense possibly damaging 0.90
IGL03154:Ralgapb APN 2 158432866 missense probably damaging 1.00
IGL03204:Ralgapb APN 2 158465912 missense possibly damaging 0.67
IGL03347:Ralgapb APN 2 158465960 missense possibly damaging 0.67
PIT4142001:Ralgapb UTSW 2 158430422 missense probably benign 0.34
R0037:Ralgapb UTSW 2 158437411 missense probably damaging 1.00
R0037:Ralgapb UTSW 2 158437411 missense probably damaging 1.00
R0077:Ralgapb UTSW 2 158473249 missense probably damaging 1.00
R0581:Ralgapb UTSW 2 158492961 missense probably benign
R0629:Ralgapb UTSW 2 158439547 missense probably damaging 1.00
R0839:Ralgapb UTSW 2 158473283 critical splice donor site probably null
R1331:Ralgapb UTSW 2 158430533 missense probably damaging 1.00
R1468:Ralgapb UTSW 2 158462253 missense possibly damaging 0.95
R1468:Ralgapb UTSW 2 158462253 missense possibly damaging 0.95
R1540:Ralgapb UTSW 2 158465826 missense probably benign 0.00
R1572:Ralgapb UTSW 2 158446199 splice site probably benign
R1628:Ralgapb UTSW 2 158430463 missense probably benign 0.04
R1718:Ralgapb UTSW 2 158443280 nonsense probably null
R1777:Ralgapb UTSW 2 158462195 missense probably damaging 1.00
R1822:Ralgapb UTSW 2 158492452 missense probably damaging 0.99
R1903:Ralgapb UTSW 2 158495563 missense probably benign 0.04
R1909:Ralgapb UTSW 2 158444675 missense probably damaging 1.00
R2157:Ralgapb UTSW 2 158437472 missense probably benign 0.15
R4524:Ralgapb UTSW 2 158437306 missense probably benign 0.00
R4946:Ralgapb UTSW 2 158440967 missense probably damaging 1.00
R4975:Ralgapb UTSW 2 158435508 missense possibly damaging 0.66
R5014:Ralgapb UTSW 2 158495535 missense probably damaging 1.00
R5165:Ralgapb UTSW 2 158465912 missense possibly damaging 0.67
R5526:Ralgapb UTSW 2 158432785 missense probably damaging 1.00
R5566:Ralgapb UTSW 2 158494710 missense possibly damaging 0.90
R5949:Ralgapb UTSW 2 158454259 missense probably damaging 1.00
R6140:Ralgapb UTSW 2 158456572 missense probably damaging 1.00
R6175:Ralgapb UTSW 2 158446155 missense probably damaging 1.00
R6192:Ralgapb UTSW 2 158449447 intron probably null
R6364:Ralgapb UTSW 2 158462109 missense probably damaging 1.00
R6458:Ralgapb UTSW 2 158444620 missense probably damaging 1.00
R6746:Ralgapb UTSW 2 158476136 missense probably damaging 1.00
R6782:Ralgapb UTSW 2 158436566 missense probably damaging 0.99
R6788:Ralgapb UTSW 2 158436566 missense probably damaging 0.99
R7017:Ralgapb UTSW 2 158448337 missense probably benign 0.19
R7108:Ralgapb UTSW 2 158492460 missense probably damaging 0.98
R7108:Ralgapb UTSW 2 158494662 missense probably damaging 1.00
R7236:Ralgapb UTSW 2 158440827 missense probably benign 0.34
R7454:Ralgapb UTSW 2 158432902 missense possibly damaging 0.94
R7485:Ralgapb UTSW 2 158443355 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGTGTATCACCTGTGCTAGTTAGC -3'
(R):5'- TAGCCTGGTGCAGAACATAGAC -3'

Sequencing Primer
(F):5'- CTGTTTCAGTACTAGGGATGAACC -3'
(R):5'- CTGGTGCAGAACATAGACCTTTC -3'
Posted On2016-10-06